Dataset for CDS HRK of organism all

[Download (right click)] [Alignment] [Repertoires]

23 sequence(s)

>gnl|bcl2dbcds|A0A2K5BYA0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Aotus nancymaae GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggtcgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G3MWR6_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos taurus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgtccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcagcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|U3E722_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Callithrix jacchus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|E2RLD4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Canis lupus familiaris GN=HRK (length=273 residues).
atgtgcccgtgccccctgcaccgcggccgcgggcccccggccgtgtgcgcctgcagcgcgggccgcctggctctgcgctc
gtccgccgcgcagctcacggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgccccgcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttg
>gnl|bcl2dbcds|A0A2K5KZ69_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Cercocebus atys GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgactgcagcgcgggtcgtttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcagcaggcggaacttgtag
>gnl|bcl2dbcds|A0A0D9SC73_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Chlorocebus sabaeus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G3QTJ6_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Gorilla gorilla gorilla GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|O00198_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Homo sapiens GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G3UH24_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Loxodonta africana GN=HRK (length=273 residues).
atgtgtccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgcctgcagcgcaggtcgcctgggtctgcgctc
gtccgccgcgcagctcaccgctgctcggctcaaggcgcttggagacgagctgcaccagcgcaccatgtggcggcgtcgcg
cgaggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggcggcgcaggtggcggcg
ctggcggcctggctgctccgcaggcggaacttg
>gnl|bcl2dbcds|A0A1D5R1E4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Macaca mulatta GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgtccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K6AYL7_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Macaca nemestrina GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A1U7R468_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Mesocricetus auratus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccacgggcctccggccgtgtgcggttgcggcgacactcgccccgggctgcgctg
ggcggcggcacaggtgaccgcgctgaggctgcaggcgctgggcgacgagctgcaccgacgcgccatgcggcgccgcgcgc
ggccccgggacccgctgcctgcgctgctgcccgcactccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|F7G1G0_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Monodelphis domestica GN=HRK (length=294 residues).
atgtgcccgtgtcccctgcaccgcggtcgcggtcccccggcggtgtgcgcctgcagctcggaccgcctggaacagcgcgc
ggcggcggcagcacagctcacggccgcccgcctcaaggcgcttggggacgagctgcaggaacggaccatgtggaggcgcc
gggcgcggagtcggcgggccgcagcggaggcggccggcagcggcggcggcgggctccccgcctactgggcttggctgtgc
gcggccgctcatgtggcggcgctggcggcctggctgctccggaggagaaacttg
>gnl|bcl2dbcds|P62816_HRK-03 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Mus musculus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgcggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|G1QHD8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Nomascus leucogenys GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|G1T7W1_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Oryctolagus cuniculus GN=HRK (length=273 residues).
atgtgcccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgcctgcagcgcgggccgcctggggctgcgctc
ggccgccgcgcagctcaccgccgcccggctcaaggcactcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttg
>gnl|bcl2dbcds|H0Y001_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Otolemur garnettii GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgtctgggtctgcgctc
gtctgccgcgcagctcacagctgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgctgccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2Q6Y8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pan troglodytes GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcgaccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A096N944_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Papio anubis GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgtttggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|H2NIS8_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Pongo abelii GN=HRK (length=276 residues).
atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccagcgcgctcccaacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K6GL98_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Propithecus coquereli GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctgggtctgcgctc
gtccgccgcgcagctcacagccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|P62817_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Rattus norvegicus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgaggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|A0A287A5N9_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Sus scrofa GN=HRK (length=276 residues).
atgtgtccgtgccccctgcaccgcggccgcggccccccagccgtgtgcgcttgcagcgcgagccgcctgggtctgcgctc
ctccgccgcgcagctcactgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgcagcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcagcctggctgctcggcaggcggaacttgtag
© 1998-2018