Dataset for CDS egl-1 of organism all

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|G0NM76_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis brenneri GN=egl-1 (length=357 residues).
atgctcacattcgcctcaacctcctcggaccttcttcttccgatgccaccatccacttcccacttcgacaacatcgtcac
catcaagccattcttcgataagaatatgatgctctactcggaattctcgtctgctcaagactttgatggcatgacaacga
caacgtcttctgacttcgctgatgattctggatttttcgatgactccgaaaccagcaacatcagcgacattggctacaag
atcggcactcaactggcagcaatgtgcgacgacttcgatgccgagatgatgtcctactccagccgatgccgatccaaaag
tcttctcgatcgtatcctcgacttcttcatcttctga
>gnl|bcl2dbcds|O61667_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis elegans GN=egl-1 (length=321 residues).
atgctgatgctcacctttgcctcaacctcttcggatcttctaccaatgtccaacgtttttgacgttcaatcttccgtttt
ctacaacgaaaagaacatgttctactcctcgtctcaggacttctcctcgtgtgaagattcttctcaatttgccgacgact
cgggattttttgatgactctgagatcagcagcatcggctacgagatcggctccaagctagcagcaatgtgcgatgacttc
gatgctcagatgatgtcctactcggcccatgcttccgacagaagcctcttccatcgtcttctggactttttcgcttttta
a
>gnl|bcl2dbcds|A0A2H2IAN0_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis japonica GN=egl-1 (length=327 residues).
atgctcgcattcacaacttctccatccacgtcctccattctgctctcgcattttgacgacatttccacgtccgtgtgctc
atctaaagacatgttcttctcctatgccacaccatcttgctctctggaggttactgctgattctgatgactcgctcgatg
attccggattctttgacgactccgacgccatccaaattggccgcgaaattggcgcacgcatcgccaccatgtgcgacgag
tttgacgccgagctgatgtcattcgccaactaccccgccaaggacagaggtcttcttgcacgtgtcctcgactttttcgc
cttctga
>gnl|bcl2dbcds|E3LTJ5_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis remanei GN=egl-1 (length=345 residues).
atgctcacattcgcctcatcctcctcatcggaccttttcctctcgatgcccaattcccacttcgacattgtcaaaccctt
ctgctgtatcaacgaaaaaaagattatgtgctccgactactgtaacacgtcttctgatgacgcctctacatcttctgagt
tcgctgatgattctggatttttcgatgactccgaaaccgacgactacatcaccaaaaccgcgtatgaaatcggcacaaaa
ctcgttgcgatgtgtgatgacttcgatgcccaaatgatgtcatactccagaacagtaccctccagaagtattctcagtcg
tgttttcgacttcttcgccttctag
>gnl|bcl2dbcds|E3M1A5_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis remanei GN=egl-1 (length=333 residues).
atgcttacattcgcctcctcttcggaccttcttatttcgatgccttcatcacactatgacttcgtcaaacccttctattc
caacaagaacatgctgttctccgatttccccacgtcttctgatcatgccgtcacgtcttctgaattcgctgacgattctg
aattttttgattcctccgaaaccagccattacattcacgagattagccaggaaatcggcaccaaattggctgcaatgtgc
gatgacttcgatgccaaaatgatgtcatactccagaagtggatccacttccagaagtcttctcggacgcttcctcgactt
cttcgccttctga
>gnl|bcl2dbcds|E3MP30_EGL1-01 Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis remanei GN=egl-1 (length=300 residues).
atgctttcattactctgtgacttcgtcaaacccttctactccaacaacttcaagaacatgatgtttttcgacttccacac
gtcttctcttcatgccgtgacgtcttctgagttcgctgaagattctggatttttagattcctccaaaaccagtcactaca
ttcacgagagaagtaaggaaatcggcaccaagttgactacaatgtgcgatggcttcgatgccaaaatgatgtcatactca
agaagtgaatctacctccagaagtcttctcgggcgtttttacgacttctttgccttctga
© 1998-2018