Dataset for CDS BIK of organism all

[Download (right click)] [Alignment] [Repertoires]

32 sequence(s)

>gnl|bcl2dbcds|A0A2K5CLG5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Aotus nancymaae GN=BIK (length=468 residues).
atgtctgaagttagacccctctccagtgacatcttgatggagaccctcttgtgtgagcagttcgtgcatcccctgaccat
ggaggttgtcggtgggagtgaccctgaagaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacg
cactggtcctgcagctggcctgcatcgcggaccagatggatgtgagccttagggcccggaggctggcccagctctatgag
gtggccatgtacagcccgggtctcgctttcatcctcgaccggaccgacatcggggatgttcttagcggtatcgtggaagt
tttcgctaacttccaggaggacatagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcag
tgctgctggcactcctggcgctgctgctggcgatgttcagcgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F7FUT7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Callithrix jacchus GN=BIK (length=468 residues).
atgtctgaagtaagacccctctccagtgacatcttcatggagaccctcctgtgtgagcagttcgtggatcccctgaccat
ggaggttgttggtgggagtgaccctgaagaggacctggaccctgtggaggaccctttggaatgcatggagaacagtgacg
cactggccctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcccagctctacgag
gtggccatgtacagcccgggtctcgctttcgtcctcgaccggaccgacatcggggatgttcttagcggtgtcgtggatgt
tttcgctaacttccaggaggacatagtgaggctctggagatccctgagctccgggtcctgggtgtcccgcaaacaggcag
tgctgctagcactcctggcgctgctgctggcgatgttcagtgggggtctgcacctgctgctcaagtga
>gnl|bcl2dbcds|F1PUF4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Canis lupus familiaris GN=BIK (length=450 residues).
atgtctcactcaggacccctctccaggaacctctttctgagcaccttcctgcaggagcatggcccagaagttctggaggt
tccgggcatgacagatctcgtggagtattatgaccctgggccctcccctaacagcaacaaccccgacgatgtggccatgc
ggctggccttcatcggggacgagatggaagtgagatggatgcttccccgcgttggcgagctgcccgggatggccatgtac
agcttggcttttacctacaaccagacaggcctgagaggtgttcttagaagtttcctggatggtcttgctaacctcaggga
gaacatccgcatctggagcttcctgaccttccggaacagggtgtcccccaacccggggcgcgggctggtgctgtcgctgc
tgctgctgctggtgctgctactaggctggggcctccgcctcctccagtga
>gnl|bcl2dbcds|H0W025_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cavia porcellus GN=BIK (length=477 residues).
atgtcggaagcaaaacctgtcgccagggacccactgatggagaccccgctgtttgagccaccccctgggcctctgctggc
tgaaggggctttgggtgtgacgcagccactgtgggcagaggacctcagtccccctggggacactaacctcatggaatgcg
tggaaggcagcagcctggtggccctgcggctggcctgcatcggtgacgagatggacctgcgcctacggagcccccgcctg
gcccagctgccagggagggcagtgcacagcctggccatcacttacagccagatggggctctggggtgtgctcggaaggct
gaccctcagtctcgccagcctcagggacaatgtgtgggcctgtggacgcccagcctcccgtgcctgggtgtccccccgct
ggacctgcaggtggctgctgcctgtgctgctgttgctgctgctgctgctggggaccctgcgcctgctgctgcagtga
>gnl|bcl2dbcds|A0A2K5LDM6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cercocebus atys GN=BIK (length=471 residues).
atgtctggagtaagacccatctccagagacacctggatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctgcgaccagacggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccatg
aacaggtgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A0D9QZY8_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Chlorocebus sabaeus GN=BIK (length=480 residues).
atgtctggagtaagacccatctccagacacatcttgatggagagcctcctgtatgagcagctcctggaacccctgaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
catagatggtttcaccacccttagggagaacataatgaggttctggagatccctgaatcccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K5J4Q7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Colobus angolensis palliatus GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgacgacatcagggatgttcttagaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A1S3FUQ7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Dipodomys ordii GN=BIK (length=450 residues).
atgtcggaggccgggtctgtcaccagggacctcttcatcaagaccctcctgtaccagcagatgcccggacctcggccggc
agccgggcttttcccgatcaccgagcctatgggggaagaggtctgggaccccatggactgtctggagggcagtaaccagg
tggccctgtggctggtgtgcatcggcgacgaaatggaccagcgcctccgaagtcctcgcctggcccagctgccggggatg
gccatacacagcctggctctgacctacagccagatgggtgtctggggagtgctccgacgcctcatccgtggggtcgccca
cctgagggcgcacatcagggcctggagaccccccatcccccgcctccaggtgtcccctggccaggtccgcaggcagatgc
tgcccgcagtgctgctgctctgcggagccctgcagctgctgctccagtga
>gnl|bcl2dbcds|F6RS78_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=240 residues).
atgtctcaagtaggacccgtctccagggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagattcccagagcccctccccacaaggagagggtgacaaccgtgactctgtggccatgc
ggctggccttcatcggggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtac
>gnl|bcl2dbcds|G3QCT2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgaggacatcagggatgttcttagaagttt
catggacggtttcaccacccttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagtgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|Q13323_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Homo sapiens GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcatgactgactctgaagaggacctggaccctatggaggacttcgattctttggaatgcatggagggca
gtgacgcattggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcctgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|I3LVX0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BIK (length=324 residues).
atggttcagggcagtcaccaggtggccctgcgactggcctgcattggggatgagatggatctgtgttttcaggacctcca
actggcccagctgcctgggatggccatgcacagccttgctctcagctacagccaggcgagagtcacgggtgtgctcagaa
gcttggcccagggtctcgccagcctcagggagaacatgtggttctggagacctgcagcccccagcacccgggtgcctcct
gcccgggcctgccgggagctgctgcccgtgctgctgctgctgggcctgttgctgagcagggccctgtacctgcggctcca
gtga
>gnl|bcl2dbcds|A0A2K5VW94_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Macaca fascicularis GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtcactgaccctgaagaggacctggaccctatggaggacttcaatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2K6DBJ4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Macaca nemestrina GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtcactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatagaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggtgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2K5XSA1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mandrillus leucophaeus GN=BIK (length=471 residues).
atgtctggagtaagacccatctccagagacaccttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
cctggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|O70337_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|O70337_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=453 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtga
>gnl|bcl2dbcds|O70337_BIK-03 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=429 residues).
atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtcccccaacctccagtggcctc
tgagactcccagcatgaaggagcctgtgagagacgtggacctcatggagtgcgtggaaggcagaaaccaggtggccttga
ggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctcaggga
aaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgaccaggaccctgggcagctgtttccgatgg
tgctgctggtcttcttgctgctgggtggg
>gnl|bcl2dbcds|O70337_BIK-04 BCL2-interacting killer gene OS=[Eukaryota] Mus musculus GN=BIK (length=321 residues).
atgttcaccagaaaccaggtggccttgaggctggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgtct
ggtccagctgcctgggattgctatacacagactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagct
tgattcgaagcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgggtgtcacctgac
caggaccctgggcagctgtttccgatggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagcttcagtg
a
>gnl|bcl2dbcds|G1S1X2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Nomascus leucogenys GN=BIK (length=480 residues).
atgtccgaagtaagacccatctccagagacatcttgatggagagcctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttgcagtgcatggagggca
gtgacgcgctggccccgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctatgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacctttaaggagaacataataaggctctggagatccccgaaccccgggtcccgggtgtcccgcg
aacagatgctgctggtgctgctggtgctgctgctgctgctgctgccgctgctcagcgggggcctgtacctgctgaattga
>gnl|bcl2dbcds|G1TZR9_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Oryctolagus cuniculus GN=BIK (length=456 residues).
atgtctgaagtcagacctggctccagggacctcttccaggaagccctcctggatgagcaggtcccagaacctctgttgac
ggcggaagttcccggcctgacccgtcccgtggaggaaggggacttggatctcatggagtgcctcgagggcagtaaccagg
tggccctgaggctggcgtacatcggcgacgagatggacctgcacgtccggggcctccacactggcccagctgccggggtg
gccatgcacagcttggccttcacctacagccagacgggcttcacgggtgttctcggaagcgtggggctccaccttgccag
cctcgtagagctctggagcccctgggggcggggggctgctgctcctgctgcagtgaggcccctcccagggcagggctggc
ccccgtcctggcgtgtggtcctccttggggcgggcagctggggcctgcggatgcca
>gnl|bcl2dbcds|H0XAE7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Otolemur garnettii GN=BIK (length=444 residues).
atgtcagcaggaaggccagtctccatggaccactttatggagaccttcccatttgagcagctcctggagcctctgacaat
ggaggttcttggcatgactgagcccaaccccatggagtgcctggaggacagtgaccaggtggccctgcggctagcctgca
ttggggacgagatggacctgcatctcaggagcccccgactagcccagctgtccaggatgaccatgcacagcctgggtcta
tcctacaaccagactgatggccagggtgtcctcagaagtgttatcagcggtttcaccaacctcagggagaatatagcagg
gttctggagatccctgagccgcgggccctgggtgtgccctgccccggcgtgggaacaggtgctgttgctgctgttgttgc
tggtgctgctgctggcagggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|W5QCU2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ovis aries GN=BIK (length=444 residues).
atgtatcaagcaagacccctctctaggaacctctttttgtacaccttcctacaaaaccacggcccaggcttcctggatga
ccaaggctcagggcttcccggcgtgaccagtatcttggagttccaccccatctccccctacagtgacagtccacactacc
tggccatgcagctggcctccattgccgacgagatggagctgaggttgctgctgccccagttcgttgagcccttctggatg
cccatgtacagcttgtgtttcccctacagccacgtagggctcagggatgttctgagaagctttatggttgctttcaccaa
cctcagggagaaccgaaggctctggagcttcctgactctcagggaccgggtgtcgcccagcctgtggcccgagctggcac
tgtccctgctggtggtggcgatgctcagctgggggtgccgcttc
>gnl|bcl2dbcds|A0A2R8ZXD2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pan paniscus GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgagtctgaggaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgacgtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccaggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|H2QLU7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pan troglodytes GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcgattctttggagtgcatggagggca
gtgacgcgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccacgcctggcccagctc
tccgacgtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A096NKG5_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Papio anubis GN=BIK (length=483 residues).
atgtctggagttagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggatgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
catggatggtttcaccacccttagggagaacataatgaggttctggagatccccgaatcccaggtcctgggtgtcccgtg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|H2P4N6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Pongo abelii GN=BIK (length=378 residues).
atgtctgaagtaagacctatctccagagacatcctgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcgtgactgactctgaagaggacctggaccctatggaggacttcagtcctttggagtgcatggagggca
gtgacgcgttggccttgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgccgggcccagctc
cccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
cacggacggtttcaccacccttaaggaaaacataatgaggttctggagctccctgtaa
>gnl|bcl2dbcds|A0A2K6FM79_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Propithecus coquereli GN=BIK (length=459 residues).
atgtctgaggtgagacccgtctccacggacctcctcatggagaccttcccgttcgagcatctcctggaccctctgatcct
ggaggttctcagcatcatggacaacgaggagaatcccgacccctcggggtgcctcgaggacagtgacgaggtggccctgc
ggctagcctgcattggggatgagatggacctgtgtctcaggagcccccgcctggcctggctgcccgggatgaccatgcac
agcctggggctggcgctgtcctgtgaccagccggtccgctggggcgtgctcgggagccttagcgacggtttcgccaacct
cagggagtacgtggccaggctctggaggtcgctcagcccccggccctgggtgtgccccgccccggcgtgggagcaggtgc
tgctgctgctgctggtgctgctgctgctgggcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|Q925D2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rattus norvegicus GN=BIK (length=477 residues).
atgtcagaggcgagactaatggccagagacattatcaagactcttctacacgaccaggtcccccaacctgcagtggtctc
tggggctcccagcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttggatttcatgaggtgcctgg
agagcagaaaccaggtggccctgaggctagcctgcatcggcgatgagatggaccggtgtcttcggagcccccgtctggtc
cagctgcctgggattgctatgcacagacttgctgccacctacagccagacgggtgtcagaggtattttcagaagcttgat
tggaagcctcaccaacctcagggaaaatatctggtcctggagagtcttcactcctggcgcctgggtgtcacctgaccagg
accctgggcagctgtttcccatggtgctgctggtcttcttgctgctgggtggggcctggcatttgcagcttcagtga
>gnl|bcl2dbcds|A0A2K6MCW0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rhinopithecus bieti GN=BIK (length=474 residues).
atgtctggagtaagacccgtctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctaggtctggctttcatctacgaccagaccgacgacatcagggatgttcttacaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccctgaatcccgggtcccaggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6QK74_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rhinopithecus roxellana GN=BIK (length=474 residues).
atgtctggagtaagacccgtctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctaggtctggctttcatctacgaccagaccgacgacatcagggatgttcttacaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccctgaatcccgggtcccaggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6TBD7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BIK (length=468 residues).
atgtctgaagacagacccctctccagcgacatcttgatggagactctcctgtgtgagcagtttgtggatcccctgaccat
ggaggttgtcggtgggagtgaccctgaagaggacccggactctgtggaggaccctttggaatgcatggagaacagtgacg
cactggccctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcccagctctacgag
gtggccacgtacagcccgggtctcgctttcatccttgaccggaccgacatcagggatgttcttagcggtgtcgtggatgt
tttcgctgacttccaggaggacatagtgaggctctggagatccctgagctctgggtcctgggtgtccggcaaacaggccg
tgctgctggcgctcctggcgctgctgctggcgatgttcagcgggggtctgcgcctgctgctcaagtga
© 1998-2018