Dataset for CDS BCL2L11 of organism all

[Download (right click)] [Alignment] [Repertoires]

235 sequence(s)

>gnl|bcl2dbcds|G1LDR8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagcccaggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgccgatatgcgcccggagatatggattgcgcaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|U3IW89_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L11 (length=105 residues).
tcctccagcggctacttctccttcgaggccgagcgcagccccgcgcccatgagctgcgacaaggccacgcagacccccag
cccgccctgccaggccgtcagccac
>gnl|bcl2dbcds|R4G9R5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L11 (length=351 residues).
atgctggtcgttggaagcagccagccacagctttgcttgcttcccaaacagctaaatgtcctctctgccaatgcttttgc
tatttcttgctttttataccgtgatgtgccgtggagaagaacagggaggagatggtgtgaggcagaaacttccagatggc
agtcacggccaattcctgaagatatgcagccagaaatatggattgcacaggaattacggcgcatcggagatgaattcaat
gcttcccactgtccaagaaggggtttcttggattaccaagcagtaaaccatcagatcataattttgcgcctgttacatta
cattgtccgcttcatttggagaatgcagtga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactgaatcctcccttgga
attgcccttcgtagggaggttcagtggccacttgagtggttagcaaaatcaagctga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacgactgttacgttacattgtcc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccatctgattga
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctgact
gggactag
>gnl|bcl2dbcds|A0A2K5CAB2_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L11 (length=318 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgatatttcattgtggtttagattt
atatttaccttctttgatttgtatggccaccaccacagtcaaggtacagaacaactccaccacaagtatttctcatga
>gnl|bcl2dbcds|Q2YDF0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=792 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattccc
ggttttaccatcgaaagccagccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaag
cccaaagaattatttctggtaatattctccaatctgtggccagatggtgccaaatgatgttgaccccacagctgtacttg
gttctcaaggacggtggccccgtggtcaaatctgctttaaaactgccatggttccactctccagtggcatga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatccgaatggatataggtgat
atttcattgtggtttagatttacatttaccttctttgatttgtgtggccaccaccacagtcaaggtacagaacaacagca
caaggatttctcatgg
>gnl|bcl2dbcds|F6XMC1_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=546 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggataca
gactcactggtcagcagccatgtctgccctggaaagtgaggggcatcggggagaagcaggaagaacgtgtgaacccacac
acatgggagaccttcaaaagcaccagaactcacagtctttcagcacgtaattctatacatccttaa
>gnl|bcl2dbcds|F6XMC1_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|F6XMC1_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|F6XMC1_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttctacctgattga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|F6XMC1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagctgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F6XMC1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=612 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattcccggttttaccatcgaaagcca
gccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaagcccaaagaattatttctggt
aatattctccaatctgtggccagatggtgccaaatgatgttgaccccacagctgtacttggttctcaaggacggtggccc
cgtggtcaaatctgctttaaaactgccatggttccactctccagtggcatga
>gnl|bcl2dbcds|J9NWV6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttgcggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgga
cctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcgtacccaag
gcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgttacattatcc
gcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaaggtaatcctgaaggcgcaggggaccgctccccccacg
gcagccctcagggcccgctggccccaccggccagtcctggcccttttgctaccagatccccgctattcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctggacctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcg
tacccaaggcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgtta
cattatccgcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaaggtaatcctgaaggcgcaggggaccgctccccccacg
gcagccctcagggcccgctggccccaccggccagtcctggcccttttgctaccagatccccgctattcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctggacctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcg
tacccaaggcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgtta
cattatccgcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcaga
attgcccttcatagggaagttcagtggccgctcgaatgcttagcatcaagctaa
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcattctggaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5NU92_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A0D9RWE0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=267 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcaga
attgcccttcatagggaagttcagtag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacagggatttctcatga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtgtttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
gtttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgttt
ttgaataa
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtctcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|B2KKY9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcgtgctcccaacgaacacgccatcgtcctgtgg
atgaacgtcattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|B8JK68_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcatgctcccaacgaacacgccatcgtcctgtgg
atgaacgacattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A1S3FHA8_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtggacagttgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccctgccaggccttcaaccattatctcagcgcaatggcttccatgaggcagtctcaggaagag
cctgcagatttgcgcccagagatatggatcgcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag
gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatggttatcttacggctgttacgttacatcattc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A1S3FHA8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtggacagttgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagagcagcaaggtaatcccgaaggcagtcccgaaggcgaaggggacc
gctgcccccaaggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca
tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatcgcccaggaattgcggcgtattggagacgag
tttgatgcctattatccaaggagggtatttttgaataattaccaagcagccgaagaccaaccccaaatggttatcttacg
gctgttacgttacatcattcgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|F7A7D2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=591 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaaggtaatcccggaggcgaaggggaccgctgcccccaag
gcagccctctgggcccgctggccccaccggccagccctggcccttttgctaccagatccccgtttttcatctttgtgaga
agatcttccctgctgtctcgctcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctct
tacccacggagggtcgttttgaatcatcaccaagcagctgaagcccacccccaaatgatcatcttgcgactgttacgtta
catcatccgcctggtacggagactgcagtga
>gnl|bcl2dbcds|A0A337SW42_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=411 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagagcaatagaggaag
gtgtcctgtag
>gnl|bcl2dbcds|A0A337SW42_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgtta
catcgtccgcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A337SW42_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctcaggctgta
cccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccagccccaaatgattatcttacgactgttacgttacatcgtcc
gcctggtatggcgattgcagtga
>gnl|bcl2dbcds|A0A337SW42_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=396 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtctttttgaataa
>gnl|bcl2dbcds|A0A337SW42_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgctgcccccaag
gcagccctcagggcccgctggccccaccagccagccccgggccttttgctaccagatccccgtttttcatctttgtcaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatat
tacccaaggaggttagagcaatag
>gnl|bcl2dbcds|A0A337SW42_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Felis catus GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagcttccatgaggcagcctcaggctgtacccgcagata
tgcgcccggagatatggattgcacaagagttgcggcgtatcggagacgaatttaatgcatattacccaaggaggctggca
agggtaccggcatcctacatctga
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtggtttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcgagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2I2YQ13_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgtt
acgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|O43521_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|O43521_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=249 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggatgcctcttcca
cctgattaa
>gnl|bcl2dbcds|O43521_BCL2L11-11 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=228 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagtctcactctgtcacccaggctggagtgcactggtgc
gatcttggctcactgcaacctccaactcccaagttcaagcggttctcctgcctcagcctcccaagtag
>gnl|bcl2dbcds|O43521_BCL2L11-12 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|O43521_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtgctttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|O43521_BCL2L11-23 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcaagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|O43521_BCL2L11-24 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|O43521_BCL2L11-25 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
>gnl|bcl2dbcds|O43521_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
>gnl|bcl2dbcds|O43521_BCL2L11-22 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|Q6JTU4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=111 residues).
atgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtatcggagacgagtttaa
cgcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|O43521_BCL2L11-19 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagagaaatagaggaagttgtcgtg
tag
>gnl|bcl2dbcds|O43521_BCL2L11-21 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|O43521_BCL2L11-18 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|O43521_BCL2L11-20 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=249 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggatgcctcttcca
cctgattaa
>gnl|bcl2dbcds|O43521_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|O43521_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgtt
acgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|O43521_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagagaaatagaggaagttgtcgtg
tag
>gnl|bcl2dbcds|O43521_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|O43521_BCL2L11-13 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|O43521_BCL2L11-15 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtgctttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|O43521_BCL2L11-16 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|O43521_BCL2L11-17 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A287DFJ0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcagagaggcctcccca
gctcaggccgggggcccctacctcccttcagacagagcctcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctcaggcagaa
cctgcagacatgcgcccggagatctggatcgcgcaggagctgcggcgaatcggagatgagtttaacctgtattacccacg
gagggtattttttaataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgttgcgttgcatcatccgcc
tggtgtggaggatgcactga
>gnl|bcl2dbcds|A0A287DFJ0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcagagaggcctcccca
gctcaggccgggggcccctacctcccttcagacagagcctcaaggtaatcccgaaggcgaaggggaccgctgcccccacg
gcagcccacagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctc
aggcagaacctgcagacatgcgcccggagatctggatcgcgcaggagctgcggcgaatcggagatgagtttaacctgtat
tacccacggagggtattttttaataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgttgcgttgcat
catccgcctggtgtggaggatgcactga
>gnl|bcl2dbcds|M3XHJ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L11 (length=477 residues).
atgccaacagaggaaagtttacaatttgacaaagaccaaggtacatcagatgtaatttctgaatgtggacatttgcatcc
cacccaaagaccagatcaaccaccgtttgtaaagcaagagggctgctactgcattatcagcccactttcaaaagtgatcg
cactggtgaggtggagagacagatctttactcagcaccctgatgggaggacttctgttgccccccagcccctgtcctttt
gtcactaggtccccgtttttcatcttcatgaggcggtccttagttttatccacatcttccagtggatattttacttttga
ctctgatatagttcatagccctgcacctgtaagtgtccacaaggctacacagactccaagcccatcaagccaactcatcg
tacacgtacagcattgcttagcgcaaagagaacagcatcccgaaactcatggtaagaaccctttgaactttacataa
>gnl|bcl2dbcds|G3SU55_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacagttacagcctgcggagaggcccccgca
gcctcctcagctcaggcctggggcccctacctctctgctcacggagcctcaaggtaatcctgacggtgaaggggacagct
gcccccagggcagcccacagggcccgcaggccccaccagccagccccggcccttttgctaccagatccccgcttttcatc
tttgtgagaagatcctccctgctgtctcgatcctccagcgggtatttctcttttgacacagacaggagcccagcacccat
gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccatcaaccattacctcagtgcaatggcttccatga
ggcagtctcaggctctacctgcagacctgcgcccggagatctggattgcgcgagagctacggcgcattggagacgaattc
aatgcctactacccaaggagggcttttttgaataattaccaagcagccgaagaccaccctcaaatggttatcttacgtct
cttacgctacatcgtccgcctggtgtggaga
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgagtggttagcatcaagctaa
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5X2I7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|F7HHA9_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|F7HHA9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|F7HHA9_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|F7HHA9_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=228 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagtctcactctgttgcccaagctggagtgcactggtac
tatcttggctcactgcaacctccaactcccaagttcaagcggttctcctgcctcagcctcccaagtag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=288 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgagtggttagcataa
>gnl|bcl2dbcds|F7HHA9_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|F7HHA9_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=414 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaccctggcccttttgctaccagatccccttgtgacaaatcaacac
aaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgcagat
atgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggtatt
tttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctggtgt
ggagaatgcattga
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6E226_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcagaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccgctcgaatgcttagcatcaagctaa
>gnl|bcl2dbcds|A0A2K5Z8B6_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L11 (length=336 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcattctagaggatataggtgat
agttcattgtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaacca
caaggatttctcatga
>gnl|bcl2dbcds|G1MV54_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L11 (length=219 residues).
tttttgctctgtgcagcttccaggtggcgatctcactcacttgcagaagaaatacaaccagaaatatggattgcacagga
gctgcggcgcatcggggatgaattcaatgcctcctattgtccaagaaggggtttcttggataaccatgctggaaaccccc
aggtggtcattctgcgcctcctgcattacatcatccgcctcatctggaggatgcagtga
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=426 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaa
cctgcagatatccgcccggagatatggattgcacaggagcttcggcggattggagacgagttcaacgaatcttacagaag
gagggtaaataattaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttacaactgttacgcttcatcg
tccgactagtatggagaaggcattga
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=270 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaagacaggagtccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggatctgtgtgagaatcttaagcacgag
tggcagattcatggtgatcaaagtaaaagt
>gnl|bcl2dbcds|A0A1U8BW10_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mesocricetus auratus GN=BCL2L11 (length=594 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaacagcaaggtaatcctgacggtgaaggggaccgctgcccccacg
gcagcccgcagggcccgctggccccaccggccagccctggcccttctgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagtccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgcagatatccgcccggagatatggattgcacaggagcttcggcggattggagacgagttcaacgaatct
tacagaaggagggtaaataattaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttacaactgttacg
cttcatcgtccgactagtatggagaaggcattga
>gnl|bcl2dbcds|F7CXT2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L11 (length=603 residues).
atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtggacaattgcagcctacagaaaggcctactca
gcctcaacaactcagaccaggggcccctacctctatacaaacacagtatcaaggtaattcaggtgaaggggacagctgct
cacccagcagtcctcagggaccgtttgcaccacccactagccctagtccatttgctaccagatccccacttttcatcttt
ttaagaagatctccactgctgcctcgatcttccagtgggtatttctcttttgacacagacaggagtccagcgcctatgag
ttgtgataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatggcttccatgaggc
agtctcaatcaatacctgcagatatgcggccagaaatttggattgcacaagaattgcgccgtattggagatgaatttaat
gcttcctattatccaagaagggggtttttggataataactatcaaggagcaggtgaccatcaccaaatggttattttacg
cctgttacgttacatcatccgccttgtttggagaatgcagtga
>gnl|bcl2dbcds|O54918_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctc
aggaggaacctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaact
tacacaaggagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctt
tatcttccgtctggtatggagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=276 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatcagttggagaatcttaaccaagtg
gcacaaaatatccacggtgatgcctggtacaactga
>gnl|bcl2dbcds|O54918_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatacgacagtctcaggaggaa
cctgaagatctgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaag
gagggtgtttgcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttcc
gtctggtatggagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=333 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagcttccatacgacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtgttt
gcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttccgtctggtatg
gagaaggcattga
>gnl|bcl2dbcds|O54918_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Mus musculus GN=BCL2L11 (length=333 residues).
atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaaccgcaagcttccatacgacagtctcaggaggaacctgaagatc
tgcgcccggagatacggattgcacaggagctgcggcggatcggagacgagttcaacgaaacttacacaaggagggtgttt
gcaaatgattaccgcgaggctgaagaccaccctcaaatggttatcttacaactgttacgctttatcttccgtctggtatg
gagaaggcattga
>gnl|bcl2dbcds|M3YDI3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L11 (length=699 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccggacggctcgcgg
cggcgggcgggctgccagtggccggctctgcgctgccccgggggctctgaaggcgagtcccaggctttgtctcccgcgct
tctttcgtgctgagggtcagggagctccgggtcggcgaaggacgcgagcgggacgccgcggggctcgggcccggacgcga
cggtcggaagggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttcagatgtaagttctgagtgtgaccgaga
aggtggacaattgcagcctgttgagaggcctcctcagctcaggcctggggcccctacctctctacagacagagcagcaag
acaggagcccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
agtgcaatggcttccaggaggcagtctcaggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttgcg
gcgtattggagacgagtttaatgcgtattacccaaggagggtctttttgaataattacccagcagccgaagcccaccccc
aaatgattatcttacgactgttacgttacatcatccgcctggtgtggagattacagtga
>gnl|bcl2dbcds|G1PDJ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L11 (length=210 residues).
tccatgcagcagtctcaggccctacctgtagacatgcgtccggagatgtggatcgctcaggagctgcggcggatcgggga
cgagttcaacaactcctaccgcaacccacggagggactttctgaatgtttaccgggaagcagaaggccacccccagatgg
tggtcttacgactgttgcgttacatcctccgtctggtgtggaggaggatg
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgtt
acgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatgtaggtgat
atttcactgtggtttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatacagaacaattcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggattgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cggagatatggattgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2I3HW02_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L11 (length=279 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccgctggatcctccctcgaa
gttcagtggccattcgagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|F7FTC8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L11 (length=435 residues).
atggccaagcaaccttccgacctaaattctgaatgtgacagcgaaggcggacgactggagcccgcagaggggccggctca
gcccccgcagctccgacccggggcacctacctctatccgaacccagtatcaagacaggagccctccgcctgtgagttgcg
ataaatcgacccagacccccagtccccactgtcaagccttcaatcattatctaagtgcaatggcttccattagacagcct
cagtctgttcctgaagatatgcggccggaaatatggattgcccaggagttacggcgaattggagatgagtttaacgcttc
ctattgtccaagaaggggtctcttggataataataatccggcaggaaacaaccaccaaatgggttttgtgcacctgttac
gttacatcatccgccgcgtttggagactgcagtga
>gnl|bcl2dbcds|G1SSY0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L11 (length=582 residues).
atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggagaggccgcccca
gctcaggcctggggcccccacctccctgcagtcggagccgcaaggtaatccggaaggcgaccgctgtgcgcacggcagcc
ctcagggcccgctggccccatcggccagccctggccctttcgctaccaggtccccgctcttcatctttgtccgaagatcc
tccctgctgtctcgatcgtccagtgggtatttctcttttgacacagacaggagcccggcacccatgagctgtgacaaatc
aacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcagtctcaggctg
aacctgcagacacgcgtccggagacctggatcgcgcaggagttgcggcggatcggagacgagttcaacgcgtattaccca
cgcagggtttttttgaataattacccagcagcggaggagcagccccaaatggttatcttgcgactgttgcgttacatcgt
gcgcctggtgtggaggatgcat
>gnl|bcl2dbcds|H0XW23_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttcagatgtaggttctgagtgtgaccgagaaggtggacaattgcaacctgcggagagacctcccca
gctcaggcctggggcccctacctctctacatacagagccccaaggtaatcccgaaggcaatccggaagtcgaaggggacc
gctgcccccaaggcagccctcagggcccactggccccaccggccagccctggtccttttgctaccagatccccgcttttc
atctttgtaagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcagtctcaggccgaacctgcagatttgcgcccggagatgtggatcgcccaagagttgcggcgtattggagacgag
tttaacgcttactacccaacgagggtatttttgcataattaccaagcagccgaagaccaccctcaaatggttatattacg
actgttgcgttacatcgtccgcctggtgtggaggctgcactga
>gnl|bcl2dbcds|W5PY58_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ovis aries GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccaggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccgcagggcccgctggccccaccggccagccccggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcggtcctccagcgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgctcaagagctacggcgtatcggagacgagtttaatgcgtat
tatccaagaagggtcttcgtgcgtcaccaggcgattgagggccacccacaaatggtcctcctgcgcgtcttgcgctacct
ggtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgtt
acgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcaagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtgctttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatgcagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=255 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctgtcctccacctga
>gnl|bcl2dbcds|A0A2R9CA99_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Pan paniscus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgaccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgaccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgaccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgaccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgtt
acgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtgctttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatgcagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcaagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2J8JCT2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgac
cggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcattctagaggatataggtgat
agttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcgga
attgcccttcatagggaagttcagtggccactggaatggttagcatcaagctaa
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtcgcttccacctgattaa
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggaggatgcattga
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggaggatgcattga
>gnl|bcl2dbcds|A0A2I3M6I1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Papio anubis GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggaggatgcattga
>gnl|bcl2dbcds|K7GA86_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2L11 (length=678 residues).
atggggcgggcagggcgcgggccgggagctgcacaatcagtgcaggcgccgcgccgcgtcccagccttttgtcccgtggc
gggggggtccgagcgcgcggctgcccgattcccagctccggccggggcggactcggagcgccggggtctggctgaggaat
tgctcttggagcctgactcgcttttgttcagacaaagcctttctgcgagttactctttggacgcaggaaaaggcgaccaa
atggcaaagcaaccttctgatctgaattcagagtgcgacggagaaggtggacagtttcagtcaattgaaaggccaagtca
gcctcagcatcttagacctggggcccctacctctatacaaacacagtaccaagacaggagccctgtgcctatgagttgcg
acaagtcgacgcagactccaagtcccccttgtcaagcctttaatcattatctaagtgcaatgggtaagcaagatcatgct
tccaggtgggagtccccctcaatacgtgaagacatgcagccagaaatatggattgcacaggagctgcggcgaattggaga
tgagtttaatgcctcttactgcccaagaaggggtttcttggataatcaagcaataaaccaccaaattgttttgcgcttgt
tgcattacatcatccgcctcatttggagaatgcagtaa
>gnl|bcl2dbcds|H2P5E2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pongo abelii GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tatggagaatgcattga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaagcttccatgaggcaatttcaggctgaacctgcagata
tgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaaggaggctggca
aaatgcctggtaccctccatctga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgcttatcttgcg
actgttacgttacattgtccgcctggtgtggaggaggcattga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcaatttcaggctgaa
cctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
gagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgcttatcttgcgactgttacgttacattgtcc
gcctggtgtggaggaggcattga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggaggatgcctcttccatctgattaa
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|O88498_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggtccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagact
tacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgatt
catcttccgtctggtctggagaaggcactga
>gnl|bcl2dbcds|O88498_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaa
cctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgag
gagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttcc
gtctggtctggagaaggcactga
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtctcttccacctgattaa
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=354 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatgtggtttggatttatatttaccaccacagtcaaga
tacagaacaactcaaccacagggatttctcatga
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcaaaactt
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K6KJP8_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=354 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatgtggtttggatttatatttaccaccacagtcaaga
tacagaacaactcaaccacagggatttctcatga
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtctcttccacctgattaa
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaacacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaacacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaacacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6QIL2_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaagacaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatccgaatggatataggtgat
atttcattgtggtttaggtttatatttaccttctttgatttgtatggctaccaccacagtcaaggtacagaacaactcca
ccacaagtatgtctcatga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccgcacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtatttttgaataattaccaagcagccgaagaccacccgcacatggttatcttacgactgttacgttacattgtcc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccgcacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccacctgattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctgact
gggactag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=291 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctcccttgcc
cttcgtagggaggttcagtgcccacttgagtggttagcaaaatcaagctga
>gnl|bcl2dbcds|G3W979_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtggacaattgcagcctacagaaaggcctactca
acctcaactcagaccaggggcccctacctctatacaaacacaatatcaaggtaattcaggtgaaggggacagctgctcac
ctagcagccctcagggaccgtttgcaccacccactagccctagcccgtttgctaccagatccccacttttcatctttgta
agaagatccccactgctgcctcgatcttctagtgggtatttctcttttgacacagacaggagtccagcgcctatgagttg
tgataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatggatacagcttccatga
ggcagtctcagtcaatacctgcagatatgcgaccagaaatttggattgcacaagaattgcgacgtattggagatgaattt
aatgcttcttatccaagaaggggttttttggataataactatcaagcagcagatgatcatcaccaaatggttattttacg
gctattacattacatcatccgccttgtttggagaatgcagtga
>gnl|bcl2dbcds|C1KGB8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
ctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|F1SU81_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|F1SU81_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgcta
catcgcccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|F1SU81_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=384 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
gagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|Q4KMV9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L11 (length=585 residues).
atggccaaacaaccgtcggtcttgagtccggactgtaatagtggtgaaggtggccagttacaatcaacaagcagacaaca
ttctcatcgccctctcagaagaggggcccccacctctcttagcagtccttttcaaggtaatcaatcagatgagggtggga
gctcctcagccagcactccatggggtcctactatatcgccttatagtcccagttcctttgtcaacagatcaccccattgc
atgctggtaagaggatcatcacttgtctccaaaacctcaagtggctatttttcattcgaagtgagtcctgggcctgtgag
ctgtgataaatcaactcaaacaccaagccctccttgtcaggcatttaatcatctcctttccgcaatggctgacagaaatc
ctgtgaatcagatgtcaccagaactgtggatagcacaggaactccggcggattggggatgactttaatgcatcattcagt
ccaagaaggggcattttcaacaaccttccacgacccttggacaacgaccaagtaataatcctgcgtgttttacgtttcat
tatccgactgatcctgagattataa
© 1998-2018