Dataset for CDS BAD of organism all

[Download (right click)] [Alignment] [Repertoires]

151 sequence(s)

>gnl|bcl2dbcds|A0A3Q1GWH9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BAD (length=498 residues).
atggctgcaaaattctcaatttcagacggcgactcagagccagaggaagtggagggagaaaacaaccattcaccagcaac
agaagccatgcctgtcttcgcccgccgcaacatggccttacctgaactcagaaccccagcatctggtcggatcaggctga
actcggagtcccacgcctccacgctctccagagatgaggagctccaggcaaagggggaagaggaagccggcacgcccaca
gagggagctccgttcagggcacggtctaagtcggctccccctgcgctgtgggccgccaagaagtacggccagcagctccg
aaggatgagcgacgagtttgacagcctgctagacaaaggggagatgaagagagtgaggagcgcagggacggccagacaga
tgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaaagccac
acacatcgcaatgagtag
>gnl|bcl2dbcds|G1MI17_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAD (length=633 residues).
gtggggaccccagagaatccctcatctgctcccacacatggcccaggcaaaaggaagtcgggaactgatcggcgggagac
gaggaagggacccaggacgaccgcgcttgcccccacagcccagagcatgttccagatcccagagtttgagcccagtgagc
aggaagactccagccctgcagataggggcctgggccccagccccacaggggaccagcccccaggccctggcaagcaccgg
cagacagccccaggcctcctaggggaagctgctcacccccaggggcagccggccagcagcaaccaccatggaggcgctgg
ggctgtggagccccggagtcgccacagctcgtaccccgcggggaccgaagaggatgaagggttggaggaggaagagctca
gccctttccgggggcgctcgagctcagcgccccccaacctctgtgctgcactgcgctatggccgcgagctccggaggatg
agcgacgagttccagggctccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcgacaaagccc
cagctggacgcgcgtcatccagtcctggtgggatcggaacttggggagaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A3Q0QNQ2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphilophus citrinellus GN=BAD (length=489 residues).
ttcatccattttcttccgtttatccagggtcgggggcagcagcctagccacctcctgcagctgatctggggaacaccaag
gcattcccaggccataggacatgaccagaacacttcacccatgaggcatcctactgccaggaggatcaggatgaactcag
agtcccacacttcctcagtctccagggatgaggagctcgtcgtcagaggggaggacgagatctgtactcccacagaggga
gatccattcaggcgaaggtcaaagtccgcaccccctgctctgtgggctgccaagaagtacggccagcagcttcgaaggat
gagtgatgagtttgacagcctactagataaagggatgaagaaggccaagaatgctgggaccaccagaaagatgcaccact
ctaaaacctggtggagctatctctttagtcaccaggagagtgatggagagaacagccatcatgaaaaccacacacaacgc
actgagtaa
>gnl|bcl2dbcds|A0A3Q0QNQ2_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphilophus citrinellus GN=BAD (length=432 residues).
atgcccgaaccacctcgactggttctttttgatgtagaagaaggacagtcacccttcagagaaggctcatttctactgct
tgtatctgtgatctcrttcttttggtcactacccaaagctttctccagggatgaggagctcgtcgtcagaggggaggacg
agatctgtactcccacagagggagatccattcaggcgaaggtcaaagtccgcaccccctgctctgtgggctgccaagaag
tacggccagcagcttcgaaggatgagtgatgagtttgacagcctactagataaagggatgaagaaggccaagaatgctgg
gaccaccagaaagatgcaccactctaaaacctggtggagctatctctttagtcaccaggagagtgatggagagaacagcc
atcatgaaaaccacacacaacgcactgagtaa
>gnl|bcl2dbcds|A0A3Q1CPU7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphiprion ocellaris GN=BAD (length=504 residues).
atggctgcaaaattcactatttcagacagcgagtcagagccatcagaggaggtagaagagggagaaaacaaccattcacc
agcaacacaagccatgcctgttttcgcccgccgcaacatggccttacctgaactcagaactccagcatctggtcggctca
ggctgaactcggagtcccacgcctccacgctctccagagatgaggagctccaggcgaggggggaagaggaagccggcacg
cccacagacggagctccgttcagggcacggtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagca
gcttcgaaggatgagcgatgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacagcca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaa
agccacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A3P8TWH6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Amphiprion percula GN=BAD (length=504 residues).
atggctgcaaaattcactatttcagacagcgagtcagagccatcagaggaggtagaagagggagaaaacaaccattcacc
agcaacacaagccatgcctgttttcgcccgccgcaacatggccttacctgaactcagaactccagcatctggtcggctca
ggctgaactcggagtcccacgcctccacgctctccagagatgaggagctccaggcgaggggggaagaggaagccggcacg
cccacagacggagctccgttcagggcacggtccaagtcggctccccctgcactgtgggccgccaagaagtacggccagca
gcttcgaaggatgagcgatgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacagcca
gacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagatggagggagagaacaaccaccatgaa
agccacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
>gnl|bcl2dbcds|A0A3Q1K1C7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Anabas testudineus GN=BAD (length=498 residues).
atggcagcaagattcaccatttcagacagcgactcagacccatcagaggggatggaggaagaaggacacaaccagtcacc
accagggcaagagcagcaagtttttccacgccacacccttaccttaccggaactcagagctagtggtcgaatcaggctga
actcagagtctcacgcttccaccgtctacagagacgaagaactccaggccaaggcagatgaggaagctggtacgcccaca
gatggagctccattcagggcacggtccaagtctgctccaccagccctgtgggcagcaaagaaatacggccagcagctcag
aagaatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaggagcgctggcacggccagacaga
tgcaccactctaagagctggtggagctacctctttagtcaccaggagactgagggagagaacaatcaccacgaaagccac
acacaccgcactgagtag
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggggctgtggagacccgaagtcgccacagctcctaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcagcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagttggacgcaagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=432 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctc
cagttggacgcaagtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcccagtgaccttcgc
tccacatcccgaaactccacccgttcccatcgccttgggcggccatcttggatatgggcggaagtgcttcctgcagggag
agctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2K5E6K7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Aotus nancymaae GN=BAD (length=459 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggtgagtactccacttgtgcctctgcttcctcatctgagaatcccagtgcaagg
atgctctcgaaagcatcagcagggatgtccgccccagccactgactcagaaaatgtaaagctggaggtgccttgctgggt
cgccacagctcctaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A3P8QRJ7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astatotilapia calliptera GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacactttcccttcctgtaaccaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3B1IH05_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=540 residues).
atgtccacagcggcgagagcggcggcggggacctgcgactccactgctgtcagccagccgtccaaactcgatttcacaat
ggatcacatgttcacaatatctgatgagtcagatgcatctgaagagctaggagactcagaccagccagaggtcagtaaga
cagctgagccatcgcggtctgggcagcacatcactgttccggagaaactcagagtagagcccaggcaaaggaatttttct
atgaatgaagaggctctgcaggagtctggtgctgggagacacgaagatggagctcgagatggagattcattccgacgccg
cagccgctcagctcccccttctctgtgggcagccaagaaatatggccgacagctgaggaagatgagtgacgagtttgaca
aggggctagagcaagggatgaagagggtgaggagtgccggagcagcccgccagatgcaaaactcccccagctggtttgcc
tttctttggagtcacaaggaatcagactctgaggcgagcagcagccgtccagcagaatga
>gnl|bcl2dbcds|A0A3B1JLM2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Astyanax mexicanus GN=BAD (length=642 residues).
atgagcaatcagtatctgctaaaactgaggagagctcgttttaattgcgacgaggagggatatagccaagcacttaacag
cagaacatcgactgaaggaggggggagagatacgcttttcaggccattgtgctggaattcatctggaagcacagttttca
caatggaaaagacaccaccacacagtaaagaagatgacatcagtcccatagatgaccacgatgaatcaaggtggtcagag
gcagtcaagagtgtcgactccccacagacggacagcgggcccagcatgtacagggacacatcatcagacgagctgttgga
ggtggggggtcgagtgaggctctactcagagtcccaagtgtacaacatcaaccgctgggaggacaatgagaaccaggatg
gcgcttcagcagaggacggtggtgtcggtgacggagcaccattccgaggccgatcccagtcagctcctgctgcgctatgg
aaagccaagaaatatggacggcagttgaggaggatgagcgatgagtttgacacctggttggacaaaggggacttaagaag
aacaactggccctgggaggcataccaaccgaggatggttctctttcctctggggtaccaaagaagaggagggaagagaat
aa
>gnl|bcl2dbcds|F1MUT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|Q3SYZ0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccgtgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgaactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacggaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|F6SJL0_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Callithrix jacchus GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agtcaaccagcagcagccaccatggagagaatcccagtgtaaggatgttctcgaaagcatcagcagggatgtccgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtggagacccggagtcgccacagc
tcgtaccccgcagggacggaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgctatggccgcgagctccggaggatga
>gnl|bcl2dbcds|F6SJL0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Callithrix jacchus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacaggcccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agtcaaccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgcagggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgatgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggataggaacttgggc
aggggaggctccgctccttcccagtga
>gnl|bcl2dbcds|F1PK10_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=624 residues).
accccagagaatccctcatctgctcccgcgcaggacccaggcacaaggaagtcaggaaccgagcggcgggagaagagctg
tgccctaactacctgctgtcttgcccccacagcccagagcatgttccagatcccagagtttgagcccagtgagcaggaag
actccagccctgcaaataggggcttgggccccagccccacaggggaccggcccccaagccctggcaagcaccagcagacg
gccccaggcctcctaggggaagctggtcaccagcaggggcagccagccagccgcaaacaccatggaggcgctggggctga
gacccggagtcgccacagctcgttccccgcggggaccgacgaggatgaaggaatggaggaagaagagctcagccctttcc
gggggcgctcgagctcagcgccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggatgagcgacgag
ttccagggctccttcaagggacttcctcgcccgaagagcgcggggacagcgacgcagatgcgacaaagccccagctggac
gcgcgtcatccagtcctggtgggatcggaacttggggagaggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|Q45KI9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Canis lupus familiaris GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcaaataggggcttgggccccagccccac
aggggaccggcccccaagccctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccagccagccgcaaacaccatggaggcgctggggctgagacccggagtcgccacagctcgttccccgcggggaccgac
gaggatgaaggaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgcgcggc
acggcgctacggccgcgagctccgcaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
cggggacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccgtcccagtga
>gnl|bcl2dbcds|A0A452ER54_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Capra hircus GN=BAD (length=528 residues).
tatcgggcttgggcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagatag
gggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaacagccccgggcctcctggggg
aagctggtcaccagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcac
agctcctaccccgcggggccagaggatgatgaagggacggaggaggaggatctcggcccctttaggggccgctcgcgttc
ggcgccccccaacctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttcacgtctccttca
aggggcttcctcgcccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctggacgcgcttcctccagtcc
tggttgagccggaacttggggaggggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A452ER54_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Capra hircus GN=BAD (length=597 residues).
atggggaccccggagaatccctcagcggctcccacaactcggaagctgagcatccggagacgtagaagagaatcaggagg
aaggcagtgggcggggccccggggaagcatgttccagatcccagagtttgagcagagtgagcaggaagactccagccctg
cagataggggcctgggccccagccccacaggggacaggcccccaggtctcaccccgggcctcctgggggaagctggtcac
cagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccc
cgcggggccagaggatgatgaagggacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgcccccca
acctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttcacgtctccttcaaggggcttcct
cgcccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctggacgcgcttcctccagtcctggttgagccg
gaacttggggaggggaggctccgccccctcccagtga
>gnl|bcl2dbcds|H0V608_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cavia porcellus GN=BAD (length=501 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcctgggccccagccccac
aggggacgagctaggcagcagcccagcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaagcagca
ggagccaccatggaggcactgtggctatggagacccggagtcgccaccggtcttatcctgcagggactgaggaggaggaa
gggatggaggaggagctcagtccattccggggccgctcgcgctcggcgccacccaacctctgggctgcacagcgctacgg
ccgagagctccggaggatgagcgacgagttcgtggactccttcaagggtcttcctcgcccgaagagcgcgggcacagcga
cgaagctgtggcagaactctaattggacacgggccatccagtcctggtgggatcggaacttggggagaggaggctccgcc
ccctcccaggagtcggtctga
>gnl|bcl2dbcds|A0A2K5M0C1_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K5M0C1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5M0C1_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cercocebus atys GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagtctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggggagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A0D9R491_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chlorocebus sabaeus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
agggaacaggccctcagactccggcaagcatcatcaccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagccccttccggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5HKW9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggagggagagcttggtattctccttctgaatctgaggactctgaaaatcccagtgca
aggatgctcacggaagcatcagcagggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K5HKW9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcttttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A3P8WIZ8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAD (length=537 residues).
atgaatgtagaagtgtccatctttccagatgtcacaatggctgcacagttcactatatcggacagcgaatccgagccgga
ggaggaagtcgagggaggaaaaattaagcattcattgaatgacccagaacaggttgtacctcaccggcacaacctcaccc
tacctgagctcagggtggcaggaagtcgtcggatcaggctaaattcagagtcacatgcttcaaccatttccagagaggaa
gccttccagtcctggggggaggaagaagccggaacgcccacagaaggagctcctttcaggggacggtccaggtcagctcc
tcctgccctgtgggcagcaaagaagtatggcaggcagctccgcaggatgagtgatgaatttgacagcctgctggacaaag
ggatgaggaaggtgaagagcgcaggcacagccagacagatgcaccactccaaaagctggtggagctacctctttagtcac
caggagctggaaggagaaaacaaccatcacgagaaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3P8WIZ8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAD (length=501 residues).
atggctgcacagttcactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaaaaattaagcattcatt
gaatgacccagaacaggttgtacctcaccggcacaacctcaccctacctgagctcagggtggcaggaagtcgtcggatca
ggctaaattcagagtcacatgcttcaaccatttccagagaggaagccttccagtcctggggggaggaagaagccggaacg
cccacagaaggagctcctttcaggggacggtccaggtcagctcctcctgccctgtgggcagcaaagaagtatggcaggca
gctccgcaggatgagtgatgaatttgacagcctgctggacaaagggatgaggaaggtgaagagcgcaggcacagccagac
agatgcaccactccaaaagctggtggagctacctctttagtcaccaggagctggaaggagaaaacaaccatcacgagaac
cacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3Q2D5S0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cyprinodon variegatus GN=BAD (length=492 residues).
atggctcagtcggtagagacttcggatcctattatggctgcaacctttaccatttcagacagcgacactgagccatcaga
ggaggtggaggaaacaagaaacaaggagccaaggatacgaaacagtgggaaaacacatcgtcggatcagactgagctcgg
agtctcacgctttcaccagagaggaggaggccaggggggaggaggaggtcgggacccccactgagggctatccattcagg
ggccgatctaattcagctcctccagctctgtgggctgccaagaagtacggccggcagcttcgaaggatgagtgatgagtt
tgtcaccctgcttgataaaggggagttgaggaaggtgagcagcacggggacgaacagaccaatacgccattccaagagct
ggtggagctacctcttcagtcaccaggagatggagggagagaacagtcaccatgaaaaccacacgcaatgcactgaacaa
agaggagaataa
>gnl|bcl2dbcds|A7MCM4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctccgatgattcagagacagaaacaatggaagacagtgaagcctcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|E7FBJ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=438 residues).
atggagaacacctcgcatgaccatcaagatgattccagcaccttggatgaaaaagagagatcacatctgaaagggacaat
caagaaccatggacaacatcaggatcgaacatcggccaacatttctcctcaagggcgtgtgcggctctattcggaatctc
aagtgtatacagtcagccgctggcaggacacagagacccaggatggagcatcggtggaggagaacggagatggacttcca
ttcaggggtcgttctcaatcagcacctgctgcactgtggaaagcaaaaaagtatggccgtcagttgaggagaatgagcga
tgaattcgacacatggctcgataaaggggtgagtaagacaccgaacagccagaaacagacctaccgaggatggttttcgt
tcctctggagtcccaaagaagaagagggcagagaatga
>gnl|bcl2dbcds|Q4V925_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=441 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttctttgga
gtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=441 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttctttgga
gtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|F7DN67_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus caballus GN=BAD (length=642 residues).
atggggaccccagagaacccctcccctgctcccacacacgcccagggcacgaggaagtcgacagccgagcatccggagac
gaggaggggacccaggaaggaaggcggggggcggagagccggtccggcggcggggagcatgttccagatcccagagtttg
agcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctacgggggactggccctcagacccg
gtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggcagccggccagcagcagccacca
tggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaggggaccgaggatgaagggatggaagggg
aggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgcacgacgctacggccgcgagctc
cggaggatgagcgacgagttccaggtctccttccaggcacttcctcgcccgaagagcgcgggcacagcgacgcagatgcg
gcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttggggagaggaggctccgccccctcccagt
ga
>gnl|bcl2dbcds|A0A3P8Y761_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=501 residues).
atggaaaatattttcactatatcagacaccgaatctgaatcctcagatgtagaagaaaccaaaaaggaatggattgccgg
acaggggaagactggaagccgattaggcctctcccttaacctaccaggcgagggccggataaggttaaactctgaatctc
aggtcttcgctacatctggtggggagaggagcggggagctccagggtttggggcaagggttgaactgtgtggccacagaa
ggactaccttttagggtccgctcccagtcagcccccccggccctctgggctgccaagagatatggacggcagctgcgacg
catgagtgacgagttcgatacgtggctggataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagatga
caacatccccgagctggtgggccttcctgttcagccacaaggaaactgagacagaaaagacccccaaccttatcattact
gaaccaagatcttctgagtag
>gnl|bcl2dbcds|A0A3P9A5G8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
>gnl|bcl2dbcds|A0A3P9A5G8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
>gnl|bcl2dbcds|A0A337SAW2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Felis catus GN=BAD (length=822 residues).
atggggaccccagagaatcccttatctgctcccacacacgtcccaggcccagggatgtcgggaactgagcagcgggaggc
gaggaagggacccaggacgaaggcggtaggcagggagcaagtcccgcggcgggggcggagactgggtcggaagcggccac
gccccctggccagccctggtgacatttcaaaagctgattgggccgggtcggtgacagttcccgttgcccaggcaactagg
gccgggctccctcagtactggagggaggcggcaggcccgggtcaggggcctcgagatcgggcttgggcccagagcatgtt
ccagatcccagagtttgagcccagtgagcaggaagactccagccctacggataggggcctgggccccagccccacagggg
accggccccgcggccctggcaagcaccagcggacgaccccaggcctcctcggggaagctggtcaccagcaggggcagccc
gccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggaccgagga
ggatgaagggacggaggaggaagagcccagccctttccggggtcgctcgcgctcagcgccccccaacctctgggctgccc
tgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaagagcgcg
ggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttggggagagg
aggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A3Q2QC80_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Fundulus heteroclitus GN=BAD (length=630 residues).
atgtcgccaagtagcagcagccatattggatgctttccttacccactgagaaatcagatcaactcgagtccaagttgcac
tttcatttctggtttgaattttccgaattcgtgtcttccagatgatacgatggcggccaagtttactatttcggacagcg
actcggagccaccagaagaagtcgaggaagaaggaaacgatcagccagcagacggaaaagtggagccgctccgccagcgc
cacgccctcacccttcctgagctcagatcagggcatggccggatcagactgaactcggagtcccacgcctccaccatctc
cagagaggaggagctgcagggcagggcggaggaggaggccgggacccccaccgaggggcttccattcaggaaccgctcca
attcggctcctccggcgctgtgggcagccaagaagtacgggcggcagcttcgcaggatgagcgacgagttcggcagcctg
ctcgataaaggggagttgaggaaggtgagcagcgctgggacgaacagacccattcaccactccaggagctggtggaacta
cctcttcagccaccaggagacggagggagagaacagccaccatgaaaaccacgccccccgcaccgagtag
>gnl|bcl2dbcds|G3Q8B3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gasterosteus aculeatus GN=BAD (length=447 residues).
atggctgcacatttcaccatttccgacagcgagtcagagccctcggatggggtagaggaaagagaagatggccagttatc
atcggggcaagagcagcagcgtcttcaacgtcacaccctcaccttacctgagctcagattgtcaggtaggaaatctcaaa
gaattgtggaaaaagaagaggagctgtggctagacgagaccgggacgcccactgagggggctccattccgggtacgttcc
aagtcggctcccccggctctgtgggcagccaagaaatacggacggcagctccgaaggatgagcgacgagttcgacagcct
gctggacaaaggggaaatgaggagggtaaagagcgccgggacgaccaaacagatgcagcactccaagagctggtggagtt
ccctctttagtcaccaggagatggagggagagaacaaccaccatgaa
>gnl|bcl2dbcds|A0A452IFQ4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gopherus agassizii GN=BAD (length=426 residues).
atgtttcgcatccaggagttcccggacgaggtgttcccggggcgagggaaggaggcgcctgctccccccgagtcgcagcg
gggacacacgcccggctccaagcagccagacacccccacagctgaggtgcgaagccggatagggtcagacaccccatctc
tggagccagaagtgcaggatgagccaggtggggcattccgggcacgttcacgctcagcaccccccatcctttgggctgct
atgcgttatgggcgggagctgcgcaggatgagtgacgagtttgatgtggcgctgcaggtgctgccacgccccaagagtgc
aggcacgacatcccagctccaccgggggaacagctggaaagagaccctccaggcctggttggggcacagacccgcccgtg
atgccctccccaggagctccaagtga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2I2Z8C7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcaggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctgcacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatacgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggaaggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A3Q3C680_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Haplochromis burtoni GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaagaagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacgctttcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3Q2Y0E4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hippocampus comes GN=BAD (length=522 residues).
atggccgcaaacttcagcatatccgacagcgagtccgagccctctgaggaggtagaagaaggggacgacggccaaggagc
cgctgaaaaagagcaggagcagtgcctccgccaaggcctccgcctcaccttgccggagctcccaatggaagcaatgtcgg
ggcggatccggctcaactcggagtcccacgctttggcagtgtcccgagaggaggagttccaggccagggtggacgaggag
gtcggcacacccaccgacggggcgccgttccgggggcgctccaagtcggctccccccgtgctatgggctgcgaaaaagta
cggacggcagctgcggcgcatgagcgacgagttcgatagcctgatggacaaaggggagttgaagttcaagagcgccggcg
gcacatccagggccatccaccactccaaaacctggtggagctacctcttcagccaccaggagacggagggcgagaacaac
aacaacaaccaccacgacaaccatgctaatcgtactgaatag
>gnl|bcl2dbcds|B4DZQ9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagccccaggcgcctgcgctaa
>gnl|bcl2dbcds|Q92934_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|Q92934_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|Q92934_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|Q92934_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|I3MBM5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=537 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaaggtgacattttcccagtccccattcctgagggcctaa
>gnl|bcl2dbcds|I3MBM5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=627 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaagggacttcctcgcccgaggagcgcaggcacagcgtcgcagatgcggcaaagctccagctg
gacgcgcttcatccagtcctggtgggatcggaacttggggaggcgaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A3Q3AEL8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAD (length=501 residues).
atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacgaggtagaggagggaaagagcaaacagccggc
agcgggaccggaggacggcgtccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccggctcagggtga
actcggagtcgctctcctccaccagctccaggggggaggaggagctcccggcgcgggcagacgacgagcccgggaccccc
accgaggggtatccgttcagggggcgatccaagtcggcccctccagccctgtgggccgccaagaagtacggccggcagct
ccgccggatgagcgacgagttcgacagcctgctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
agatacaccactcccgaagctggtggaactacctctttagtcaccaggagacggacggcgagagcagccaccacgagaag
ccgacccaccgcaccgagtaa
>gnl|bcl2dbcds|A0A3Q3AEL8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAD (length=501 residues).
atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacgaggtagaggagggaaagagcaaacagccggc
agcgggaccggaggacggcgtccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccggctcagggtga
actcggagtcgctctcctccaccagctccaggggggaggaggagctcccggcgcgggcagacgacgagcccgggaccccc
accgaggggtatccgttcagggggcgatccaagtcggcccctccagccctgtgggccgccaagaagtacggccggcagct
ccgccggatgagcgacgagttcgacagcctgctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
agatacaccactcccgaagctggtggaactacctctttagtcaccaggagacggacggcgagagcagccaccacgagaag
ccgacccaccgcaccgagtaa
>gnl|bcl2dbcds|A0A3Q3MLA0_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=666 residues).
atgaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaaaaagcagtcggttatctgcgcaggttacgg
cactgtgaatacctttggaccggcttacagcagggacagcacagagaataagatatcctgcttgggtgtgttagatgtca
cgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggtaaaagaggaagagaacgaccaatca
tcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagctcagactggcagggactggtcggat
caggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccaggccaggggggaagaagaggctggca
cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccgg
cagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggagatgaaaaaagtaagaagccctgggccagc
caaacagatgcaccactccaagagttggtggagctacctcttcagccaccaggagacagagggagagaacaaccaccacg
aaaaccacacccaccgcaatgagtaa
>gnl|bcl2dbcds|A0A3Q3MLA0_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=561 residues).
atggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggtaaaagaggaagagaacgaccaatcatc
agctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagctcagactggcagggactggtcggatca
ggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccaggccaggggggaagaagaggctggcacc
cccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccggca
gctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggtgagaattaaaggggggggggggggtagcaggg
gtggctgtggattagtggtggagtcggtcgtctctcaaccgaaaagtcaggagttcaatacccagctcctgcagccacat
gtccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaatactgatcatcactttacacagcagcctcta
g
>gnl|bcl2dbcds|A0A3Q3MLA0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=588 residues).
atgacactaacagcaagtgatgtcacgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggt
aaaagaggaagagaacgaccaatcatcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagc
tcagactggcagggactggtcggatcaggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccag
gccaggggggaagaagaggctggcacccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgcctt
gtgggcagctaaaaaatacggccggcagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggtgagaa
ttaaaggggggggggggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaaccgaaaagtcaggag
ttcaatacccagctcctgcagccacatgtccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaatact
gatcatcactttacacagcagcctctag
>gnl|bcl2dbcds|H3ANP3_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=510 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagttttttggggatttacagataacatggagattctggggcgtcca
agttccgagtcccagatctcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacc
taacttctgggccgcaaggaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttc
cgaggccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaagggg
cgcgggcaacccagggacccgcctgggcaa
>gnl|bcl2dbcds|H3ANP3_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=525 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacaggtgtatacggttgggtaaaacttaggaagcgaaataacatggag
attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagcttggccctttcaggacaaggtc
tcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgt
cctttctggggcttccgaggccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa
>gnl|bcl2dbcds|H3ANP3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=522 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagataacatggagattctggggcgtccaagttccgagtcccagatc
tcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaag
gaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgaggccaaagagcgctg
gagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaaggggcgcgggcaacccagggac
ccgcctgggcaacagggagtgtcgatccgaggacctgactaa
>gnl|bcl2dbcds|H3ANP3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=522 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagataacatggagattctggggcgtccaagttccgagtcccagatc
tcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaag
gaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgaggccaaagagcgctg
gagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaaggggcgcgggcaacccagggac
ccgcctgggcaacagggagtgtcgatccgaggacctgactaa
>gnl|bcl2dbcds|C1C3S9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lithobates catesbeiana GN=BAD (length=453 residues).
atgggggattctcctcataagtctatgtttagtattgaagagtttccaccgacagaaagggggtctgcattttctggaac
aaatcctccaggttttggaggagatcctggacacaagagttcccctaacttgagacgaataaaaggaaaagaaactcggc
aacggacagaatctgcttcagaagcctcagagacggacagtgttggagagcttcaacatttccgctcacgttcccgctct
gctccatcttctctaatggttgcagctcgatatggacgagagctgaggcgaatgagtgatgaattcgaccaaatcttcac
gagtatccctcgacctaaaagtgcaagtgcagccactgagatgaccgttagcaagagtttcggagaaacattttttaact
tctttagaagaaagaacaaagaccgaagtcagtcagaaaacgacaagcactga
>gnl|bcl2dbcds|G3TP47_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Loxodonta africana GN=BAD (length=621 residues).
ggacccccagagaatccctcaccggcttccacacacgcccaaggcgtgaggatgtcgggagctgaacatccggagaagaa
gaagggacgcaggagatcatcgggcgggctgcagagtatgttccagatcccagagtttgagcagagtgaccgggaagact
ccacccctgcagacaggggcctgggccccagccccgaagggtactggccttcaggccccagcgaccgccaccgtgtggcc
ccaggcttcctgcgggactccagtcaccagcaggggcagccgaccagcagcggccaccatggaggtgctgcggctgtgga
gacccggagtcgccacagctcataccccgcagggtctgatgaggctgaagggctggaggaggatcccagcccctttcggg
gtcgctcgctttcagcgccccccaacctctgggctgcacagagatatggccgtgagctccgcaggatgagtgatgagttc
cagggctatttcaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagccccagctggacacg
catcatccaggcctggtgggatcggaatttggggagaggcagctccgccccgtctcagtga
>gnl|bcl2dbcds|A0A2K5VCD8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|A0A2K5VCD8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K5VCD8_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|Q2PG01_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca fascicularis GN=BAD (length=249 residues).
atggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaaggggcttcctcgcccgaagagcgcgggcacagcgacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccc
tcccagtga
>gnl|bcl2dbcds|F7GVS7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|F7GVS7_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=249 residues).
atggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaaggtgagcgccggaccccctcccaggccgccccgcgccg
gtctgtcccttccttgtcccaaggcacgtccggatctgatgtcccacgatccctccccaacgccgtcctgccccttccta
gctccatag
>gnl|bcl2dbcds|F7GVS7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|F7GVS7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca mulatta GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K6E7J3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca nemestrina GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgcaccctcccagtgaccttcgc
tccacgcccggaaactccacccgctctcactgtcctcgtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2K6E7J3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca nemestrina GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccgcagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgcaccctcccagtga
>gnl|bcl2dbcds|A0A2K6E7J3_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Macaca nemestrina GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccgcagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggggagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaa
gctgaaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2K5XJR2_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mandrillus leucophaeus GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcctcgc
gggggacaggccctcagactgcggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcaccgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
catgcaaaagaggatccgtgctgcctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A3Q3RXS8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mastacembelus armatus GN=BAD (length=468 residues).
atggctgcaaaattcagtatttcagaaagcgaatcagactcatcagaggaggtagagggaggaaaacagaagaagtcgtc
agcaaggcaagagcaacaggtttctcagcgccacgcccttgccttacctgagctcagaacaacagcctccaatcgaatca
ggctgagttcggagtcccagtccagggtggatgaggaggctggtacgcccacagacggagctccatttaggggaaggtcc
aagtcagctccccctgctctgtgggcagccaagaaatatggccagcagctccgaaggatgagcgatgagtttgacagcct
cctggataaaggggaaatgagagtgaggaatgctggcaaggcccaaaagatgcaccactctaaaacctggtggagctacc
tctttagttaccaggagacagatggagaaaacaacctccatgaaaaccacacaccccgcacagagtag
>gnl|bcl2dbcds|A0A3Q3RXS8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mastacembelus armatus GN=BAD (length=468 residues).
atggctgcaaaattcagtatttcagaaagcgaatcagactcatcagaggaggtagagggaggaaaacagaagaagtcgtc
agcaaggcaagagcaacaggtttctcagcgccacgcccttgccttacctgagctcagaacaacagcctccaatcgaatca
ggctgagttcggagtcccagtccagggtggatgaggaggctggtacgcccacagacggagctccatttaggggaaggtcc
aagtcagctccccctgctctgtgggcagccaagaaatatggccagcagctccgaaggatgagcgatgagtttgacagcct
cctggataaaggggaaatgagagtgaggaatgctggcaaggcccaaaagatgcaccactctaaaacctggtggagctacc
tctttagttaccaggagacagatggagaaaacaacctccatgaaaaccacacaccccgcacagagtag
>gnl|bcl2dbcds|A0A3P9B2E4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Maylandia zebra GN=BAD (length=393 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacgctttcccttcctgtaaccaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggtaagaatgggagtgagtcaaggcttaaattag
>gnl|bcl2dbcds|A0A3Q3WTY4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mola mola GN=BAD (length=438 residues).
atggctaccaatttcaccatttcaagtgacagcgagtcagagctgtcagaggaaatagaagaaggagaaaacagtcagct
acaaactgagcaagagcagcaggtttttcaacgtcacaccctcaccctacctgagctcaggatggcaggtaggacactgc
aggttaagggggaagacgaggctgggacgcccaccgatggagctccgttcaggggcaggtccaaatctgctcccccttct
ttgtgggcagccaagaaatatggacagaggctccgaaggatgagcgatgaatttgacaggcaagaatggaagacgaggag
tgctgggacggccacacagatgcaccagtctcgaagctggtggagctacctctttagtcaccaggagacggacggagaga
acaaccatcatgatagccacacgcatcgtaatgagtag
>gnl|bcl2dbcds|A0A3Q3R5S3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Monopterus albus GN=BAD (length=507 residues).
atggctgcaaacttcacgatttcagacagtgaatcagagtcttcggaggaggtagaggaaggaaaacacagccaatcatc
aacttcgcaagaacaacaggttcctccatgccacagccttaccttacctgagctcagaatggcagcaaccagtcgaaaca
gggtgagctcggagtccaatgcttccactgtccaggatgccaagtcagatgaggaggctggtacacccacagacggagct
ccattccggggacggtccaagtcagctccccctgctctgtgggcagcaaagaaatatggccggcagctccgaaggatgag
cgatgagtttgacagtctgctggacaaaggggagatgaagagggtgaggagtgccggggcggccagccagatgcaccact
ctaaaagctggtggagctacctctttagtcatcaggagacagagggagagaacacccaccatgaaaacgcggcgctggct
caggaggtagagcgggtcgtttcctaa
>gnl|bcl2dbcds|Q61337_BAD-05 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=396 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaaggtgagcgccagcgttaggtgcgatgggacctga
>gnl|bcl2dbcds|Q61337_BAD-06 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacac
agatgcgacaaagcgccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccc
tcccagtga
>gnl|bcl2dbcds|Q61337_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacac
agatgcgacaaagcgccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccc
tcccagtga
>gnl|bcl2dbcds|Q61337_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagacgctagtgctacagataggggcctgggccctagcctcac
tgaggaccagccaggtccctacctggccccaggtctcctggggagcaacattcatcagcagggacgggcagccaccaaca
gtcatcatggaggcgcaggggctatggagactcggagtcgccacagttcgtacccagcggggaccgaggaggatgaaggg
atggaggaggagcttagcccttttcgaggacgctcgcgttcggctccccccaatctctgggcagcgcagcgctacggccg
tgagctccgaaggatgagcgatgagtttgagggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacac
agatgcgacaaagcgccggctggacgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccc
tcccagtga
>gnl|bcl2dbcds|Q61337_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=537 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtgctacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggcgcaggggctatggagactcg
gagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatggaggaggagcttagcccttttcgaggacgct
cgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggagaagagctgacgtacagcttgagtcccttccggtgcgtgcaatag
>gnl|bcl2dbcds|Q61337_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mus musculus GN=BAD (length=615 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtgctacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcaacattcatcagcagggacgggcagccaccaacagtcatcatggaggcgcaggggctatggagactcg
gagtcgccacagttcgtacccagcggggaccgaggaggatgaagggatggaggaggagcttagcccttttcgaggacgct
cgcgttcggctccccccaatctctgggcagcgcagcgctacggccgtgagctccgaaggatgagcgatgagtttgagggt
tccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagcgccggctggacgcgcattat
ccagtcctggtgggatcgaaacttgggcaaaggaggctccaccccctcccagtga
>gnl|bcl2dbcds|M3YNE7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Mustela putorius furo GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggatcaacccccaggccttggcaagcacctgcagacggccccaggcctcctaggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggctgtggagacgcggagtcgccacagctcgtaccccgcggggacc
gaggaagatgaggggatggaggaagaagagcttagccctttccgggggcgctcgcggtcagcgccccccaacctctgtgc
ggcactgcgttacggccgcgagctccggaggatgagcgacgagttccagggctccttcaaggggcttcctcgcccgaaga
gcgcaggcacagccacgcagatgcgacagagccccagttggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|G1P8C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Myotis lucifugus GN=BAD (length=525 residues).
cctacagcccagagcatgttccagatcccagagtttgagcacagtgagcaggaagactccagccctgcagataggggcct
gggcccctgccccacaggggaccagcccccaggcctcaacaagcactggagtacggtcccaggtctcctgggggaagctg
gtcaccagcagggccagccggccagcagcagccaccatgacggcgctgggtctgtggagccgcggagtcgccacagctcg
taccccacggggaccgaggaggatgacgacaccgaggagggggagcccagccccttccgcggccgctcgcgttcagcgcc
cccaaacctctgggcagcacagcgctacggccgcgagctccggaggatgagcgacgagttccagggctcctttaagaagg
gtctccctcgcccgaagagcgctggcacagcaacgcagatgtggcaaaagtccagctggacgcgctttttccagtcctgg
tgggatcggaactcggggagaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A3Q4GGN3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Neolamprologus brichardi GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagagacatcagaggaggtaggggaaggagaaaaccaacagtcagc
aagacaagttcaagaaagcaagccccagacgctctcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtctgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A2I3H4B2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Nomascus leucogenys GN=BAD (length=249 residues).
atgggggaggagcccagcccttttcgcggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccg
cgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcgcgggcacagcaacgc
agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccc
tcccagtga
>gnl|bcl2dbcds|I3K7B6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oreochromis niloticus GN=BAD (length=435 residues).
atggctgcaaacttcacaatttcagacagtgaatcggagacatcagaggaggtaggggaagaagaaaaccaacagccagc
aggacaagatcaagaaagcaagccccagacacttgcccttcctgtaatcaaaacgacagtacaacccaaccagtggaacg
cacttggcatgagggatgaggacctcatggctagaggggaggatgaggtctgtactcccacagagggagacccattcagg
cgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggccagaagcttcgacggatgagtgacgagtt
tgacagcctactagataaaggggagatgaagctcaagaagctgcaccactctaaaacctggtggagctacctctttagtc
accaagagactgaaggagagaacaaccatcttgaa
>gnl|bcl2dbcds|G1SS60_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryctolagus cuniculus GN=BAD (length=342 residues).
ccgcgccccaaacccctctccgcaggcgccggagctatggaaacccggagccgccacagctcgtaccctgcggacgcgga
cgacagcgaaggggccgaggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggctgcac
agcgctacggccgcgagctccgaaggatgagcgacgagttcgagggctccgtcaagaagggactgcctcgcccgaagagc
gcgggcacagcgatgcagatgagggaaagctccagctggacgcgcgtcatccagtcttggtgggatcgcaatttggggaa
aggaggctccgccccttcccag
>gnl|bcl2dbcds|A0A3B3HDU2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias latipes GN=BAD (length=495 residues).
atggcagcaaagttcaccatctcagacgattcggagtcatccgaggaggtagagggaggaaaacttgacctgggagcggc
agcaggaggagaaggggagcaccttcatgatcgacattccctcaccctgccagagcttcgactcacaagtaacgggcgta
ccaggctgaattcagagtccaccgcttccacgtactccagagatgaggacctcgcgcgggaagacgaggccggaaccccc
actgatgggttggccttcaggggcagatccaagtcggcccctccggctctgtgggccgccaaaaagtacggtcagcagct
ccgacggatgagcgacgagtttgacagcctgctggataaaggggagatgaggaaggtgaggagcactggggcggccaaac
agatgctccactccacgagctggtggaactacctcttcagccacccggaggcggaaggagagtacagccaccacgagagc
caccgcactgagtaa
>gnl|bcl2dbcds|A0A3B3BQF7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oryzias melastigma GN=BAD (length=510 residues).
atggcagcaaagttctccatctcagacaacgattcggagtcatccgaggaggtagagggaggaagacttgacctggcagc
atcaggaggagaaggaggaggaggaggaggggggcaccttcatgatcgacatgccctcaccctgccagagcttcgactta
caagtaacgggcgtaccaggctgaattcagagtccaccgtttcgacgtactccagagatgaagacctcccgcgggaagac
gaggctggaacccccaccgacgggttggccttcaggggccgatccaagtcagcccctccggccttgtgggccgccaagaa
gtacggccagcagcttcggaggatgagcgacgagttcgacagcctgctggataaaggggagatgaggaaggtgaggagcg
cgggggcgaccaaacagatgcaccactccacgagctggtggaactacctcttcagccacccggaggccgaaggagagtac
agccaccacgaaagccaccgcaccgagtag
>gnl|bcl2dbcds|H0WVR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Otolemur garnettii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctcctcagataggggcctgggccccagcccctc
aggggaccagcccctaggccccggcaagaaccgctgcacgactccaagtctcctgggggacgccagtcacctgcaggggc
agccggccagcaacacccaccatggagcaggacctggggcagtggagacccggagtcgccacagctcgtacccggcaggg
acagaggaggatgaagggattgaagagcccagccccttccggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgaactccggaggatgagtgacgagttcgaagactccttcaagaagggacttcctcgcccgaaga
gcgcaggcacagcgacacagatgcgacagagctccagctggacgcgtgtcattcagtcctggtgggatcggaacgtgggc
aggggaggttccgccccctgccagtga
>gnl|bcl2dbcds|W5P8G9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ovis aries GN=BAD (length=540 residues).
caggggcctcgttatcgggcttgggcccagagcatgttccagatcccagagtttgagcagagtgagcaggaagactccag
ccctgcagataggggcctgggccccagccccacaggggacaggcccccaggtctcagcaagcactggctaacagccccgg
gcctcctgggggaagctggtcaccagcaggggcagccggccggcagcagccaccatggaggcactggggctgtggagacc
cggagtcgtcacagctcctaccccgcggggccagaggatgacgaagggacggaggaggaggatctcggcccctttagggg
ccgctcgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcgagctccgaaggatgagcgacgagtttc
acgtctccttcaaggggcttcctcgcccgaagagcgcgggcacggcaacgcaaatgcgacaaagccctagctggacgcgc
ttcctccagtcctggttgagccggaacttggggagaggaggctccgccccctctcagtga
>gnl|bcl2dbcds|A0A2R8Z697_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2R8Z697_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2R8Z697_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan paniscus GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcgggctccagcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacttt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacccagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgcttgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2I3TBK7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pan troglodytes GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacccagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgaccccgattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2I3MCN5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2I3MCN5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=492 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattctccttcttgggaatctgaggactctgaaaatcccagt
gcaaggatgctcgcggaagcatcagcaccgatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaa
gctgaaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagcacagcgttatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|A0A2I3MCN5_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=471 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagatctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctc
cagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgaccttcgc
tccacgccccgaaactccacccgctctcactgtcctggtcggccatcttggatatgggcggaagtgcttccctcaggcct
tatgcaaaagaggatccgtgctccctctttcggtgggagggctgacccagattcccttccggtgcatgtga
>gnl|bcl2dbcds|A0A2I3MCN5_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Papio anubis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagatctgcagagaggggcctgggccccagccccgc
gggggacaagccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacgcggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A3B3QX41_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BAD (length=510 residues).
atgtcgggtgtcaccatggcgcacatgtttaccatctccggcaatgagtcggacacttctgaatccgacacaccagatgt
cacagcaaattcacagcttggaaataacctcaaaaatacgaaaaatccaggagaggctggaggtcgtgtacggatgcggt
ccgaatcccaggtttcttcgattcgaagcgaggatctcgattttggtgaaggaggtgcatctgaggagggcggaggcgtg
tgccccggggatggcactccttttcgaggacgctcgcggtcagccccgcccgcgctgtgggcagcacagcggtatggacg
acagctgcggcgtatgagtgacgagtttgacaccctgctggacaaagggatgaagagggtgcgcagtgccggggctgccc
gacagatgcaggcgtcccccagctggttcgcctttctctggagccacaaggagagcgacgcggagatcagcggaagcttg
tcgaccgccgacagcagagctgcacagtga
>gnl|bcl2dbcds|A0A087X8P8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia formosa GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaagtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtatggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B3UA11_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia latipinna GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaagtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtacggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B3YFR1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia mexicana GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactcggagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaggtcgggaccccc
actgagggctttccattcaggggccgatctaattcagctcccccctccctgtgggccgccaagaagtatggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtaccgggtcgaacagac
cgatacaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3P9Q7C3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Poecilia reticulata GN=BAD (length=501 residues).
atggacgcaaaatttacaatttcagacagcgactctgagccatcggaagacgtagaggaaagaggaaacttgcagctaat
gcaagtaaaggagaggccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggaggagctgcaggccaggggggaagaggaggtcgggacccca
actgagggctttccattcagggtccggtctaattcagctcccccctccctgtgggccgccaagaagtacggccggcagct
tcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgaggaaggtgagcagtgccgggtcgaacggac
cgatccaccactccaggagctggtggagctacctcttcagtcaccaggagacggagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A2J8TYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pongo abelii GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacaggccctcaggctccagcaagcatcatcgccaggccccaggcctcctgcgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaatctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccaatcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K6GWV0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Propithecus coquereli GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgcaggtaggggcctgggccccagcccctc
aggggaccggccctcaggccccggcaagcatccctgcacggctccaagcttcctgggggacgccagtcaccagcaggggc
agcccagcagcagcagccaccatggaggagctgggtctgtggagacccggagtcgccacagctcgtaccccgcggggaca
gaagaggatgaagggatggaggaagagcccagccccttccggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgagctccggaggatgagcgacgagttcgaggactccttcaagaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatacggcagagctccagctggacgcgcgtcattcagtcctggtgggatcggaacgtgggc
aggggaggttccgccccctcccagtga
>gnl|bcl2dbcds|A0A3B4GXJ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pundamilia nyererei GN=BAD (length=477 residues).
atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagaggaggtaggggaaggagaaaaccaacagtcagc
aggacaagctcaagaaagcaagccccagacgctttcccttcctgtaatcaaaacgacagctgctggaaggctcagggtga
actcagagtcccacacttcctcaattgccagggatgaggagctcatggctagaggggaggatgaggtttgtactcccaca
gagggagacccattcaggcgaaggtcaaagtcagctccccctgctctgtgggctgccaagaagtacggcaggcagcttcg
acgaatgagtgacgagtttgacagcttactagataaaggggagatgaaggtcaagaagctgcaccactctaaaacctggt
ggagctatctctttagtcaccaagagactgaaggagagaacaaccatcttgaaaaccacaaccaacgcactgagtaa
>gnl|bcl2dbcds|A0A3B4CPH6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pygocentrus nattereri GN=BAD (length=477 residues).
atggctcatatgttcacattatcggacgactcagacacatctgaagatctaggagacgcagaccagccagaagccagtaa
gagagctgagctgtcacagtctgggcagcacccacttgttccagagagattcagagagtcaaggcagaggaatcactcta
tgaatgaggatgcccttcaggaatctggggctgtgagacatggagatggagctgcagatggagactctttccgccgtcgc
tgtcgctcggctccccctgctctgtgggcagcaaagaaatatggcagacagctgaggaagatgagtgacgagttcgacac
cttgctggacaaagggatgaagagagtgaggagtgcaggtgcagcccgtcagatgcacgcttcccccagctggttcacct
tcttatggagccacaaagagtcagactctgaggccagcagcagtctaacagctccagacacccgtccggcagagtga
>gnl|bcl2dbcds|A0A3B4DUY7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pygocentrus nattereri GN=BAD (length=621 residues).
atgagcaatcaatatctgcagaaactgaggagagctcgttttaattgcgaagaggagcgatataagaaagtaattaaaac
actgactggagagaaaggaacgccttttaacccattgtgctggaattcattaagaaccacagcttgcgcaatggaaaagc
acagtgaagatggcataagtaccatggatgaccaagatgaatccaattggtcagagacggtcaagaatggtgactctcca
cagctggacagtcagcacagcatggcaagcaacatatcaccagcttccccagacgaactgtcagaggttgggtgtcgtgt
tcggctgtactctgagtcccaggtgtacacggtcagccgctggcaggacaatgaggatgggcttttagcggaggacggtg
gagcaggggatggagctccattccgaggccgatcccagtcggctcctgctgcactgtggaaagccaagaaatatgggcgg
cagctgaggaggatgagtgatgaatttgacacctggctggataaaggggacacaagaagagcgagcagccctgggaagca
gacgaaccgaggatggttctcttttctctggggttccaaagaagaagaaggaagagaataa
>gnl|bcl2dbcds|O35147_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=618 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggcgctgggactatggagac
ccggagtcgccacagttcgtacccagcggggactgaggaagatgaagggatggaggaggagcttagcccttttcgaggac
gctcgcgctcggctccccccaatctctgggcagcgcagcgctatggccgtgagctccgaagaatgagcgatgaatttgag
ggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagcgccagttggacgcgcat
tatccagtcctggtgggatcgaaatttggggaaaggaggctccactccctcccagtga
>gnl|bcl2dbcds|Q6P7C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=345 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggtaggttcctcacttccat
cattttcctgtcccatgtcccctga
>gnl|bcl2dbcds|A0A2K6N1A1_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus bieti GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattatcctgctgaatctgaggactctgaaaatcccagtgca
aggatgctcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K6N1A1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus bieti GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K6PUM5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggtacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K6PUM5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus roxellana GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattatcctgctgaatctgaggactctgaaaatcccagtgca
aggatgctcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggagccgtggagacacggagtcgccacagctcgtaccccgcagggacg
gagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactccttcaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagagaatcccagtgcaaagatgctctcgaaagcatcagcagggatgtctgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggagccgtggagacacggagtcgccacagc
tcgtaccccgcagggacggagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgatatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=432 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctc
cagctggacgcgagtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcccagtgaccttcgc
tccacatcccgaaactctacccgctcccatcgccctgggcggccatcttggacatgggcggaagtgcttcctgcagggag
ggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|B5X1T1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=471 residues).
atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacatgatgagtctgaccactcaggaaccac
acactacccagaatttcagcgccattatgtctccactaggacgggcatcagaccacgaccaggtgggcgagtgcggctct
actccgagtcccaggtgtgctcccaggttggcagaagggacaacacagagtttcaggatgtgatgactcctactgaggag
ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctcctacactgtgggctgcaaagaaatatggccg
ccagctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaacccaagagagggataagcccaggagggg
tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
>gnl|bcl2dbcds|B5XEF1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=444 residues).
atggactacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacgcaactcagaattccagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgcgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggtcgatcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattatcccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|G3VRY4_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sarcophilus harrisii GN=BAD (length=522 residues).
atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccactgcccccagcctcgccccgct
caggccaggaccccgagcagcacctggagcccaccaccatgagaaggggggagcccagaagtcccagacccatgtctcaa
aagagctcaaagcctctgctagtcaagggagattaggaaaaggcagtttcgagggtagggagggctcccgggaggcgagc
cccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgcggcctcttccggggccgctccagctcagcgcc
ccctatcctctgggcggcgcggcattatggcagcgagctgcgcaggatgagcgacgagttccactgcaccttcaagggac
ttccccgcccgaagagcgcaggcactgcgagccagatgcgtcggagccatggctggacccgcaccttccagtcttggttc
gggcggaatttggggaaagggagcgtcggtccttcccactga
>gnl|bcl2dbcds|G3VRY4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sarcophilus harrisii GN=BAD (length=474 residues).
atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccactgcccccagcctcgccccgct
caggccaggaccccgagcagcacctggagcccaccaccatgagggcgccggcgcggggaggcctcgcctgatctcctacc
ccccgctaagggagggctcccgggaggcgagccccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgc
ggcctcttccggggccgctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcgagctgcgcaggat
gagcgacgagttccactgcaccttcaagggacttccccgcccgaagagcgcaggcactgcgagccagatgcgtcggagcc
atggctggacccgcaccttccagtcttggttcgggcggaatttggggaaagggagcgtcggtccttcccactga
>gnl|bcl2dbcds|A0A2U9BAC9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Scophthalmus maximus GN=BAD (length=504 residues).
atggcggcaaacttcacaatatcagacagtgagtcagagccatcggaggaggtggaggaaggagaagtgagccaaccgtg
gaccgggccaggggagcaggttcctccgcgccacaccctcgccctccctgagctgcgaatggcagcaaccggtcgaatcc
ggctgaactcggagtccaacgcttccactctctcacgagacgaggagctcctgaccaggtgggacgaggaagccggtacg
cccaccgacggagctccattccgggggaggtccaagtcggctcctcctgcgctgtgggcggccatgaaatacggccagaa
gctccggcggatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgccgggacggcca
gacagatgcaccactctcaaagctggtggagctacctctttagtcaccaggagatggaaggagaaaacaaccaccacgag
aaccacactcaacgcaacgagtag
>gnl|bcl2dbcds|A0A3B4VFC5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Seriola dumerili GN=BAD (length=504 residues).
atggctgcaaacttcaccatttcagacagtgagtcagagccatcggaggaggtagacgaaggagaaatgagccaatcact
aactgggcaagagcaggagctttctcaacgccacaccctcaccttgcctgaactccgaggggcagcgaccggtcgaacga
ggctgaactcagagtcccacacttccactgtctccagagacgaagagttccaggccaggggggaggaggaagccggcacg
cccaccgaaggagctccattcaggggacggtccaagtcagctccccctgcactgtgggcggccaagaaatacggccagaa
gctcagaaggatgagcgacgaatttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgctgggacagcca
aacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagacagaaggagaaaacaaccaccatgaa
aaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3B4W9T1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BAD (length=504 residues).
atggctgcaaacttcaccatttcagacagtgagtcagagccatcggaggaggtagacgaaggagaaatgagccaatcact
aactgggcaagagcaggagctttctcaacgccacaccctcaccttgcctgaactccgaggggcagcgaccggtcgaacga
ggctgaactcagagtcccacacttccactgtctccagagatgaggagttccaggccaggggggaggaggaagccggcacg
cccaccgaaggagctccattcaggggacggtccaagtcagctccccctgcactgtgggcggcgaagaaatacggccagaa
gctcagaaggatgagcgatgaatttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgctgggacagcca
aacagatgcaccactctaaaagctggtggagctacctctttagtcaccaggagacagaaggagaaaacaaccaccatgaa
aaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3B5BAL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Stegastes partitus GN=BAD (length=501 residues).
atggctgcacaattctctattagtggcagcgagtccgacccggaggaggtagaagagggagaaaacaaccatccaccagc
agaacagccgatgcatgtcttcgagcgccgcaacctcgccttacctgaactcagaaccccagccgccggccggatcaggc
tgaactcagagtcccacgcgaccacggtctccagagacgaggagctccaggccaggggggaagaggaggccggcacgccc
actgacggagctccgttcaggggacggtctaagtcggctccacctgcactgtgggccgccaagaagtacggccagaagct
gcgaaggatgagcgacgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacggccaaac
agatgcaccactctaaaagctggtggagctacctctttagtcaccaggagctggagggagagaacaaccaccatgaaaac
cacacacatcgcaatgagtag
>gnl|bcl2dbcds|A0A287AEF3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=627 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgtagcggccccgcctcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacagggacagacccccagccctggcgcacg
gccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgt
ggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagcccct
tccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgac
gagttccagggttccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccccagctg
gaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A287AEF3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=354 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagacaggggcctgggccccagccccac
agggacagacccccaggccccagcaagccctggcgcacggccccaggccacctgggggaagctggtcaccagcaggggca
gccggccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcttacccagaggggaccg
aggaggatgaagggactgaggatgaggagctcagccccttccgcggccgatcgctctcggcgccccccatcctctgggct
gcacagcgttatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A3B5K831_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Takifugu rubripes GN=BAD (length=507 residues).
atggcgacgaggttcagcatttccagcgacagcgactcggatccctcggaggaggtggacgaaggagagaggaatagttc
tctaagtgagcaggagaggcaggttcttcagcggcacaccctgactctacctgaactcagactgacaggtaccagtcgga
ccagggtcagctcggagtcccaggcgtccaccttctccagagaggaagagcttcaggggaacgtggaggatgaggccggg
acgcccacggaaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgggccgcgcagagatacggccg
gcagctccggagaatgagcgacgagttcgacagcttgctggataaaggggggatgaggaagaccaacagcaccggatcga
ccaaaccgatgcaccactcccggagctggtggagctacctgttcagccaccaggagacggagggcgagaacggccaccac
gacggccacacgcaccgcactgagtag
>gnl|bcl2dbcds|H3D8J8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Tetraodon nigroviridis GN=BAD (length=420 residues).
atggctgcaaagttcagtctgtgcagcgacagcgactcagagccatcagaggaggtggaagaaggagagaggggcagttt
ttcaacaagcggtcggatcagggtcaactcggaatcccaagcatccgccgtctccagagacgaggagctccagggcaacg
gggacgacgaggccgggacgcccaccgacggagccccgttcagggggaggtccagatcggctccccccgccttgtgggct
gccaagaaatacggccggcagctccggagaatgagcgacgagttcgacagcctgctggataaagggggaatgaggaagac
cagcagcgccggctcggccaggcagatgcaccactcccgcagctggtggagctacctgttcagccaccaggagacggaga
gcgagaacaaccaccacgac
>gnl|bcl2dbcds|A0A452RJM6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus americanus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcaaccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A384DJL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus maritimus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcacccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|F6Z067_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xenopus tropicalis GN=BAD (length=456 residues).
atggcagattcatccccttcagcagttttcaagttagaggaattcgataatgaggaacagggattacctttgccttttgt
ggatccccctcgtggggcaggcgttcgacaacctgtagctaagagttctcccagcctgcgaagatacccagggaaggagt
cacgtttacgcactgagtctgcttcagagtccagtgagacagacaaagtgggcgagctccatcctttccgttcccgttcc
cgttctgctccgtcttcaatgatcgctacaaaatatggacgggagttaagaagaatgagtgatgaatttgaaaaaagctt
cacgggccttcctcgtccaaagagtgcaagtgcagcgggtcagatgactgggaacagaagcattcgagacttaatcatgg
gcttgttctcaagacggaaaagtaaaggaagggatgagtctggggatgaggagtga
>gnl|bcl2dbcds|A0A3B5L9R9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xiphophorus couchianus GN=BAD (length=450 residues).
atggacacaaaatttacaatttcagacggtgagtcggacccatcggaagacgtagaggaaagaggagacttgcagctaat
gcaagaaaaggagaagccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaaaggtggagctgcagg
ccaggggggaagaggaggtcgggacccccactgagggctttccattcaggggccgatctttatcagctcctccctccctg
tgggctgccaagaagtacggccggcagcttcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgag
gaatgtgagcagtgatgggtcgaacagaccgattcaccactccaggagctggtggagctacctcttcagtcaccaggaga
cagagggagagaacaaccaccacgaaaaccacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B5Q2N7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xiphophorus maculatus GN=BAD (length=501 residues).
atggacacaaaatttacaatttcagacggtgagtcggacccatcggaagacgtagaggaaagaggagacttgcagctaat
gcaagaaaaggagaagccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggtggagctgcaggcaaggggggaagaggaggttgggaccccc
actgagggctttccattcaggggccgatctttatcagctcctccctccttgtgggctgccaagaagtacggccggcagct
tcggaggatgagtgatgagtttgtcaacctgcttgataaaggggaaatgaggaatgtgagcagtgatgggtcgaacagac
cgattcaccactccaggagctggtggagctacctcttcagtcaccaggagacagagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
© 1998-2019