Dataset for CDS PMAIP1 of organism Xiphophorus maculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B5RFA9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=PMAIP1 (length=123 residues).
cttcctgccgctgctgagctctgcgctcgcgagctgcggcaagttggagataaattgtactggagatacaaactcctgga
aatgctgctcaagaactatgagactctcaacaaaataaaatga
© 1998-2019