Dataset for CDS classical BH3-containing proteins of organism Xiphophorus maculatus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A3B5Q2N7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xiphophorus maculatus GN=BAD (length=501 residues).
atggacacaaaatttacaatttcagacggtgagtcggacccatcggaagacgtagaggaaagaggagacttgcagctaat
gcaagaaaaggagaagccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaacaggtcgggtgagac
tgaactcggagtccatcgcttccaccatctccagagaggtggagctgcaggcaaggggggaagaggaggttgggaccccc
actgagggctttccattcaggggccgatctttatcagctcctccctccttgtgggctgccaagaagtacggccggcagct
tcggaggatgagtgatgagtttgtcaacctgcttgataaaggggaaatgaggaatgtgagcagtgatgggtcgaacagac
cgattcaccactccaggagctggtggagctacctcttcagtcaccaggagacagagggagagaacaaccaccacgaaaac
cacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B5QAM1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L11 (length=735 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggaggagagggaggaggacgaagaggggagccggactcggactcgccgccttgctccgtgagcccggccagt
ttagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactc
gctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagcctcaccggccaggtga
tgaaccacgccctgcagcgaatggctgtggagcacggtggactcggcctgcacgggcagtctcccaaccactatagcact
attaacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtgctattggagatgagtacaacaacctcct
gatgggaaggaggatggcgagaggacaccaacggaatatagtccctctaaacctgatgccgcacatccagcaagagcctg
ttgccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccatgac
cactctcaggtttag
>gnl|bcl2dbcds|A0A3B5QAM1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L11 (length=753 residues).
atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggg
gaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgg
gcgcctccacagccgggggaggaggaggaggagagggaggaggacgaagaggggagccggactcggactcgccgccttgc
tccgtgagcccggccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatactt
ctcctttgactgcgactcgctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca
gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacggtggactcggcctgcacgggcagtct
cccaaccactatagcactattaacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtgctattggaga
tgagtacaacaacctcctgatgggaaggaggatggcgagaggacaccaacggaatatagtccctctaaacctgatgccgc
acatccagcaagagcctgttgccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggc
aacacaagcagccatgaccactctcaggtttag
>gnl|bcl2dbcds|A0A3B5QK08_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Xiphophorus maculatus GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctggccaggcactacacaacggcatgctgccctgtggtgttgtggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctccatcgggcagaa
acttcagctgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttgatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A3B5QK08_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Xiphophorus maculatus GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagatcccaactgctggcgcacacccttcagggagataaagtgcgaaga
ccggggcacgcagacgcccggtcctggccaggcactacacaacggcatgctgccctgtggtgttgtggaggagcccagac
gactattctacggtaacgcaggttttcgattgcacttcccagcgcattttgaacttgtcggggattttgacgcgaggcaa
caagaggagcagaacaggatggagcagttacccctgcaccagccggctgcactcagcttggaggcctccatcgggcagaa
acttcagctgataggcgaccagtttcaccgggaacacttacaacagtatcaacaaaaccaaaggaatcaggggccgctgt
ggtggcgcatgactgcagctcttctcagcctcctgtttgatagggggtttattgctggaggaggtggagcaggacggagg
tga
>gnl|bcl2dbcds|A0A3B5RFA9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=PMAIP1 (length=123 residues).
cttcctgccgctgctgagctctgcgctcgcgagctgcggcaagttggagataaattgtactggagatacaaactcctgga
aatgctgctcaagaactatgagactctcaacaaaataaaatga
© 1998-2019