Dataset for CDS BCL2L11 of organism Xiphophorus maculatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B5QAM1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L11 (length=735 residues).
atgcactctttaagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggggaccggcggagacccagc
atcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgggcgcctccacagccgggg
gaggaggaggaggagagggaggaggacgaagaggggagccggactcggactcgccgccttgctccgtgagcccggccagt
ttagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatacttctcctttgactgcgactc
gctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagacccccagcctcaccggccaggtga
tgaaccacgccctgcagcgaatggctgtggagcacggtggactcggcctgcacgggcagtctcccaaccactatagcact
attaacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtgctattggagatgagtacaacaacctcct
gatgggaaggaggatggcgagaggacaccaacggaatatagtccctctaaacctgatgccgcacatccagcaagagcctg
ttgccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggcaacacaagcagccatgac
cactctcaggtttag
>gnl|bcl2dbcds|A0A3B5QAM1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L11 (length=753 residues).
atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggg
gaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgg
gcgcctccacagccgggggaggaggaggaggagagggaggaggacgaagaggggagccggactcggactcgccgccttgc
tccgtgagcccggccagtttagacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccagcggatactt
ctcctttgactgcgactcgctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca
gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacggtggactcggcctgcacgggcagtct
cccaaccactatagcactattaacgcggcacgggatatgcagtcagaaacctatggtcgtcaactccgtgctattggaga
tgagtacaacaacctcctgatgggaaggaggatggcgagaggacaccaacggaatatagtccctctaaacctgatgccgc
acatccagcaagagcctgttgccatgctttgtgtctgccttctgctcctcctggtcggacgaataatgtacatgcaaggc
aacacaagcagccatgaccactctcaggtttag
© 1998-2019