Dataset for CDS classical BH3-containing proteins of organism Xiphophorus couchianus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B5L9R9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xiphophorus couchianus GN=BAD (length=450 residues).
atggacacaaaatttacaatttcagacggtgagtcggacccatcggaagacgtagaggaaagaggagacttgcagctaat
gcaagaaaaggagaagccgctcagtcaacgccacaccctcacgcttcctgagctccgatctacaaaggtggagctgcagg
ccaggggggaagaggaggtcgggacccccactgagggctttccattcaggggccgatctttatcagctcctccctccctg
tgggctgccaagaagtacggccggcagcttcggaggatgagcgatgagtttgtcaacctgcttgataaaggggaaatgag
gaatgtgagcagtgatgggtcgaacagaccgattcaccactccaggagctggtggagctacctcttcagtcaccaggaga
cagagggagagaacaaccaccacgaaaaccacgcctcccgcaccgagtag
>gnl|bcl2dbcds|A0A3B5M375_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xiphophorus couchianus GN=BCL2L11 (length=630 residues).
atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcgatggctcgaccgaagtaacgccagcagaggg
gaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgcgcgccgcaggcgg
gcgcctccacagccgggggaggaggaggaggagaaggagaaggacgaagaggggagccggactcggactcgccgccttgc
tccgtgagcccggccagtttagacgtctttcgaagcaggtcgatatttcgccctacccgccgctcatccagcggatactt
ctcctttgactgcgactcgctgccgagctccccgctctctccgcacccagtgacggctgacaaagccacgcagaccccca
gcctcaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcacggtggactcgggctgcagggtgagcaa
acttcagtcctccctcctcccccttctgaaacatcaacaacatgggaacaaatagctgttaatatcggcccagttttatt
tatcaggccgataccgatgttagtgccgatatatcatgcatccacgttaagaatctcagctctcgagtaa
© 1998-2019