Dataset for CDS classical BH3-containing proteins of organism Xenopus tropicalis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|F6TGJ4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Xenopus tropicalis GN=BMF (length=546 residues).
caggagagttacctgaatatggatgagttagatgacgatgtgttttatcctgatgaatttggatacccagatcagaccat
gacttcctccacagtattcaaccagagccagtcctacacatgcctgctgagccgctttcacctcttcccactttctcact
gttgtggccctggatgcaggggcgcagactacgaagacaaggctacgcagactctgggttccccttccatcagccaggac
atcatgctaccctgtggggtgtctgaaacccctcaaagacttttttatggacatgcaggatacctattatatctccctca
gaattctccggcccgttttggagaagaggttgacaacaggaggcaagaacagagcgcagagcatcggatcgcccgcaaac
tgcagtgtattggagaccagtttcacaggtttcatctgcagagacttcaacagaaccgaaatcagttttggtctcagatc
ttaatcttcttccgcaacttggtaatgcatccagtggggaatagagccgggctggctcagaggtga
>gnl|bcl2dbcds|F6Z067_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Xenopus tropicalis GN=BAD (length=456 residues).
atggcagattcatccccttcagcagttttcaagttagaggaattcgataatgaggaacagggattacctttgccttttgt
ggatccccctcgtggggcaggcgttcgacaacctgtagctaagagttctcccagcctgcgaagatacccagggaaggagt
cacgtttacgcactgagtctgcttcagagtccagtgagacagacaaagtgggcgagctccatcctttccgttcccgttcc
cgttctgctccgtcttcaatgatcgctacaaaatatggacgggagttaagaagaatgagtgatgaatttgaaaaaagctt
cacgggccttcctcgtccaaagagtgcaagtgcagcgggtcagatgactgggaacagaagcattcgagacttaatcatgg
gcttgttctcaagacggaaaagtaaaggaagggatgagtctggggatgaggagtga
>gnl|bcl2dbcds|Q4KMV9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Xenopus tropicalis GN=BCL2L11 (length=585 residues).
atggccaaacaaccgtcggtcttgagtccggactgtaatagtggtgaaggtggccagttacaatcaacaagcagacaaca
ttctcatcgccctctcagaagaggggcccccacctctcttagcagtccttttcaaggtaatcaatcagatgagggtggga
gctcctcagccagcactccatggggtcctactatatcgccttatagtcccagttcctttgtcaacagatcaccccattgc
atgctggtaagaggatcatcacttgtctccaaaacctcaagtggctatttttcattcgaagtgagtcctgggcctgtgag
ctgtgataaatcaactcaaacaccaagccctccttgtcaggcatttaatcatctcctttccgcaatggctgacagaaatc
ctgtgaatcagatgtcaccagaactgtggatagcacaggaactccggcggattggggatgactttaatgcatcattcagt
ccaagaaggggcattttcaacaaccttccacgacccttggacaacgaccaagtaataatcctgcgtgttttacgtttcat
tatccgactgatcctgagattataa
© 1998-2018