Dataset for CDS BMF of organism Xenopus tropicalis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6TGJ4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Xenopus tropicalis GN=BMF (length=546 residues).
caggagagttacctgaatatggatgagttagatgacgatgtgttttatcctgatgaatttggatacccagatcagaccat
gacttcctccacagtattcaaccagagccagtcctacacatgcctgctgagccgctttcacctcttcccactttctcact
gttgtggccctggatgcaggggcgcagactacgaagacaaggctacgcagactctgggttccccttccatcagccaggac
atcatgctaccctgtggggtgtctgaaacccctcaaagacttttttatggacatgcaggatacctattatatctccctca
gaattctccggcccgttttggagaagaggttgacaacaggaggcaagaacagagcgcagagcatcggatcgcccgcaaac
tgcagtgtattggagaccagtttcacaggtttcatctgcagagacttcaacagaaccgaaatcagttttggtctcagatc
ttaatcttcttccgcaacttggtaatgcatccagtggggaatagagccgggctggctcagaggtga
© 1998-2018