Dataset for CDS classical BH3-containing proteins of organism Ursus maritimus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A384D070_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ursus maritimus GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagatcctgctcttcttacacaacctcgctttgaacgcagatgagaacagggatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A384DJL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus maritimus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcacccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A452TE71_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ursus maritimus GN=PMAIP1 (length=162 residues).
tggggctccctgctcagtggggagcctgcttctccctctccctctgctgcaccccctcccgaagtggagtgtgccattca
actcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaacct
ga
>gnl|bcl2dbcds|A0A452U4S4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L11 (length=255 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggatctttggaccgtggagagacatctg
gaaaccgcactgtga
>gnl|bcl2dbcds|A0A452V3L2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ursus maritimus GN=BIK (length=534 residues).
atggcttggagctcagaagaagctaggtcaagagaagaaatgtcccacacaggacccctctccaggaacctctttttgag
caccttcctgcaggagcatggcccggaagttctggaggttccgggcatgactgatctcgtggagtactatgatccggggc
cctcccctaacagcaacaaccccgacgatgtggccatgcggctggccttcatcggggacgagatggaagtgagatggatg
cttccccgcgttggcgagctgcccgggatggccatgtacagcttggcttttacctacaaccagacaggcctgagaggtgt
tcttcgaagtctcatggacggactcactaacctcagggagaacataaggatctggagcttcctgaccttcaggaacaggg
gcctggatttggagccttccctgcccgccacccagccccagagccgatccagcagatgcagtgactcaccacctccggcc
gggctggtcaggtcctgcccactcccagctgccccgtccggccctcacgactga
© 1998-2019