Dataset for CDS BIK of organism Ursus maritimus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452V3L2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ursus maritimus GN=BIK (length=534 residues).
atggcttggagctcagaagaagctaggtcaagagaagaaatgtcccacacaggacccctctccaggaacctctttttgag
caccttcctgcaggagcatggcccggaagttctggaggttccgggcatgactgatctcgtggagtactatgatccggggc
cctcccctaacagcaacaaccccgacgatgtggccatgcggctggccttcatcggggacgagatggaagtgagatggatg
cttccccgcgttggcgagctgcccgggatggccatgtacagcttggcttttacctacaaccagacaggcctgagaggtgt
tcttcgaagtctcatggacggactcactaacctcagggagaacataaggatctggagcttcctgaccttcaggaacaggg
gcctggatttggagccttccctgcccgccacccagccccagagccgatccagcagatgcagtgactcaccacctccggcc
gggctggtcaggtcctgcccactcccagctgccccgtccggccctcacgactga
© 1998-2019