Dataset for CDS BAD of organism Ursus maritimus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A384DJL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus maritimus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcacccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
© 1998-2019