Dataset for CDS classical BH3-containing proteins of organism Ursus americanus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A452QUG1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ursus americanus GN=BIK (length=441 residues).
tttcacaccacccgcaggtgcgctcagcgggtggtagcaccctccctccaccaccagcaccccgcaggggaaggtgctgt
cctgacaggtgcgggtggcatatgtcaggccacgggccctttgtgcaacaaccccgacgatgtggccatgcggctggcct
tcatcggggacgagatggaagtgagatggatgcttccccgcgttggcgagctccccgggatggccatgtacagcttggct
tttacctacaaccagacaggcctgagaggtgttcttcgaagtctcatggacggactcactaacctcagggagaacataag
gatttggagcttcctgaccttcaggaacagggtgtccccccacccggggcgcaggctggtgctgtccctgctgctgctgc
tggggctgctgctaggctgggggttccgcctcctccagtga
>gnl|bcl2dbcds|A0A452RJM6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus americanus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcaaccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
>gnl|bcl2dbcds|A0A452SBG5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ursus americanus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacaactgcagcctgctgagaggcctcctca
gctcaggcctggggcccctacctctctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggatgta
cctgccgatatgcgcccggagatttggattgcgcaagagttgcggcgtattggagacgaatttaatgcatattacccaag
gagggtctttttgaataattaccaagcagccgaagcccacccccaaatgattatcttgcgactgttacgttacatcatcc
gcctggtgtggagattgcagtga
>gnl|bcl2dbcds|A0A452SED0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ursus americanus GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctggaggatgatgtgttccagccagaggacggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcatctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctgagcccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgcaggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggggagcagcccccagaagggccgtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcacatgcagcaacaccagcaaaaccaaaatcgagtgtgg
tggcagatcctgctcttcttacacaacctcgctttgaacgcagatgagaacagggatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A452STA4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ursus americanus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaagcgcgtaagagcgcgcaggcgagccctgcgcggaccccggcagagcccgaagtggagtgtgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaa
cctga
© 1998-2019