Dataset for CDS BIK of organism Ursus americanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452QUG1_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ursus americanus GN=BIK (length=441 residues).
tttcacaccacccgcaggtgcgctcagcgggtggtagcaccctccctccaccaccagcaccccgcaggggaaggtgctgt
cctgacaggtgcgggtggcatatgtcaggccacgggccctttgtgcaacaaccccgacgatgtggccatgcggctggcct
tcatcggggacgagatggaagtgagatggatgcttccccgcgttggcgagctccccgggatggccatgtacagcttggct
tttacctacaaccagacaggcctgagaggtgttcttcgaagtctcatggacggactcactaacctcagggagaacataag
gatttggagcttcctgaccttcaggaacagggtgtccccccacccggggcgcaggctggtgctgtccctgctgctgctgc
tggggctgctgctaggctgggggttccgcctcctccagtga
© 1998-2019