Dataset for CDS BAD of organism Ursus americanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452RJM6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ursus americanus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggaccagcccccaggccctggcaagcaccggcagacagccccaggcctcctaggggaagctgctcaaccccaggggc
agccggccagcagcaaccaccatggaggcgctggggctgtggagccccggagtcgccacagctcgtaccccgcggggacc
gaagaggatgaagggttggaggaggaagagctcagccctttccgggggcgctcgagctcagcgccccccaacctctgtgc
tgcactgcgctatggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcgacaaagccccagctggacgcgcgtcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccaatga
© 1998-2019