Dataset for CDS classical BH3-containing proteins of organism Tursiops truncatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2U4BC98_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Tursiops truncatus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgccggctaccggctccccctccc
tgccggtttccctgcaggcttgccccttggtgagcagcccgctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagcgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctctttctgcacaacctcgctttgaatggagacgagaacaggaatggggcgggtcccaggtga
© 1998-2019