Dataset for CDS BAD of organism Tetraodon nigroviridis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H3D8J8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Tetraodon nigroviridis GN=BAD (length=420 residues).
atggctgcaaagttcagtctgtgcagcgacagcgactcagagccatcagaggaggtggaagaaggagagaggggcagttt
ttcaacaagcggtcggatcagggtcaactcggaatcccaagcatccgccgtctccagagacgaggagctccagggcaacg
gggacgacgaggccgggacgcccaccgacggagccccgttcagggggaggtccagatcggctccccccgccttgtgggct
gccaagaaatacggccggcagctccggagaatgagcgacgagttcgacagcctgctggataaagggggaatgaggaagac
cagcagcgccggctcggccaggcagatgcaccactcccgcagctggtggagctacctgttcagccaccaggagacggaga
gcgagaacaaccaccacgac
© 1998-2018