Dataset for CDS classical BH3-containing proteins of organism Tarsius syrichta

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatgggcttat
ttgaataa
>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtccatgaggcagtctcaggctgaa
cctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
gagggcttatttgaataataaccaagcagccgaagatcacccacaaatggttctcttacgactgttacgttacattgtcc
gcctggtatggagaatgtattga
>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgag
tttaacgcttattatccgaggagggcttatttgaataataaccaagcagccgaagatcacccacaaatggttctcttacg
actgttacgttacattgtccgcctggtatggagaatgtattga
>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgag
tttaacgcttattatccgaggaggatgccctttccacctgattaa
>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaagagtccatgaggcagtctcaggctgaacctccagata
tgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgaggaggctggca
aaaaacctagcatcctcctcttga
>gnl|bcl2dbcds|A0A1U7SU38_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Tarsius syrichta GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaagggggacaattgcagcctgccgagaggcctcccca
actcaggcctggggcccctacctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggcgaaggggacc
gctgcccccacggcagccctcagggcccactggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatcgcacaggagttgcggcgtatcggagacgag
tttaacgcttattatccgaggaggttagagaaatag
>gnl|bcl2dbcds|A0A1U7UD37_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Tarsius syrichta GN=BMF (length=390 residues).
atggatccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagtcggggacccagtctgg
gagcttgctctctgcagatctctttgcccagagccaactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggtcctggccttcgacacaccagccaggaagacaaggccacccagaccctcagtccagcctccccgagccag
ggtgtcatgctgccttgtggggtaaccgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgcatgtggt
ggcagatactcttcttcctacacaacctcgctttgaatggagaagagaacaggaacggggccggtcctag
>gnl|bcl2dbcds|A0A1U7UD37_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Tarsius syrichta GN=BMF (length=555 residues).
atggatccatctcagtgtgtggaggagctggaggatgatgtgttccaaccagaggatggggagtcggggacccagtctgg
gagcttgctctctgcagatctctttgcccagagccaactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggtcctggccttcgacacaccagccaggaagacaaggccacccagaccctcagtccagcctccccgagccag
ggtgtcatgctgccttgtggggtaaccgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttccctgcaggcttgccctttggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctacatgtgcagcaacaccagcagaaccgaaatcgcatgtgg
tggcagatactcttcttcctacacaacctcgctttgaatggagaagagaacaggaacggggccggtcctaggtga
© 1998-2018