Dataset for CDS classical BH3-containing proteins of organism Takifugu rubripes

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B5K831_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Takifugu rubripes GN=BAD (length=507 residues).
atggcgacgaggttcagcatttccagcgacagcgactcggatccctcggaggaggtggacgaaggagagaggaatagttc
tctaagtgagcaggagaggcaggttcttcagcggcacaccctgactctacctgaactcagactgacaggtaccagtcgga
ccagggtcagctcggagtcccaggcgtccaccttctccagagaggaagagcttcaggggaacgtggaggatgaggccggg
acgcccacggaaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgggccgcgcagagatacggccg
gcagctccggagaatgagcgacgagttcgacagcttgctggataaaggggggatgaggaagaccaacagcaccggatcga
ccaaaccgatgcaccactcccggagctggtggagctacctgttcagccaccaggagacggagggcgagaacggccaccac
gacggccacacgcaccgcactgagtag
>gnl|bcl2dbcds|A0A3B5KWG6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Takifugu rubripes GN=BMF (length=444 residues).
atggacgatgaggaggatgatgtatttcagccagacccttacagctggcgcaccacattccaggagataaagtgcgagga
ccggggcacgcagacacctggcccgaccctggcaccgcacagcggcatgcttccctgtggagtcgcagaagagcccagac
tactcttctacggtgaggccggcgacacgcttcattacaccggaggggcgcccaacgggatggagccgctgccccagcag
ggtcctgtggtgcgcagcacggaggcttgcattggccagaagctccagctgattggggatcagtttcatcgggaacgcgt
tcaattgtatcagcgaaaccaaaggaaccagggcccgctgtggtggcgcctgggcaccgctctgctcagccttctgtttg
acaggggcttcgtcgctggaggaggaggagcggggcggaggtga
© 1998-2019