Dataset for CDS BAD of organism Takifugu rubripes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2SV06_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Takifugu rubripes GN=BAD (length=423 residues).
atggcgacgaggttcagcatttccagcgacagcgactcggatccctcggaggaggtggacgaaggagagaggaatagttc
tctaataggtaccagtcggaccagggtcagctcggagtcccaggcgtccaccttctccagagaggaagagcttcagggga
acgtggaggatgaggccgggacgcccacggaaggagccccgttcagaggaaggtccaggtcagcgcctcccgccttgtgg
gccgcgcagagatacggccggcagctccggagaatgagcgacgagttcgacagcttgctggataaaggggggatgaggaa
gaccaacagcaccggatcgaccaaaccgatgcaccactcccggagctggtggagctacctgttcagccaccaggagacgg
agggcgagaacggccaccacgac
© 1998-2018