Dataset for CDS PMAIP1 of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A287AZR7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=216 residues).
ttatctaaggaaacatttatggccaaaggaaaagtgctgtttgcaagtatgccacacagaagctccaataagaataccca
gacaaatcctctgaggttggcgctcccgccgctgcccgcggtcaaatgcagaatagggctaaggcgtgtgggcacaaagc
tggctatcaggcagcagataacaaatttcataatcttttttttttttttagggccg
>gnl|bcl2dbcds|F1SMU1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=366 residues).
gcgcgggcagcggcgggagcgccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccgcttgc
tcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttctcgga
gttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaaccctacg
cgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttccggca
gaaacttctgaatctgatagccaaactcttccgcctaggaacctga
>gnl|bcl2dbcds|Q9GL49_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=531 residues).
atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatcggcaggatgggaggaattggtaagaagcca
gccccgggcacatcaaggtctcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttccttcggtccgc
ctcccgctgccgtccgaggaaaccaaccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccg
cttgctcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttc
tcggagttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttc
cggcagaaacttctgaatctgatagccaaactcttccgtctaggaacctga
© 1998-2018