Dataset for CDS classical BH3-containing proteins of organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

16 sequence(s)

>gnl|bcl2dbcds|A0A287A5N9_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Sus scrofa GN=HRK (length=276 residues).
atgtgtccgtgccccctgcaccgcggccgcggccccccagccgtgtgcgcttgcagcgcgagccgcctgggtctgcgctc
ctccgccgcgcagctcactgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgcagcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcagcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A287AEF3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=627 residues).
atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaataaggaagtccggagctgaaccagggacccc
ggaggaaggcggtgggcggggccggagccgtagcggccccgcctcccagagcatgttccagatcccagagtttgagcaga
gtgagcaggaagactccagccctgcagacaggggcctgggccccagccccacagggacagacccccagccctggcgcacg
gccccaggccacctgggggaagctggtcaccagcaggggcagccggccagcagcagccaccatggaggcgctggggctgt
ggagacccggagtcgccacagctcttacccagaggggaccgaggaggatgaagggactgaggatgaggagctcagcccct
tccgcggccgatcgctctcggcgccccccatcctctgggctgcacagcgttatggccgcgagctccggaggatgagtgac
gagttccagggttccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccccagctg
gaagcgcttcctccagtcctggtggtaccggaactcggggagaggaggccccgccccctcccaatga
>gnl|bcl2dbcds|A0A287AEF3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Sus scrofa GN=BAD (length=354 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagacaggggcctgggccccagccccac
agggacagacccccaggccccagcaagccctggcgcacggccccaggccacctgggggaagctggtcaccagcaggggca
gccggccagcagcagccaccatggaggcgctggggctgtggagacccggagtcgccacagctcttacccagaggggaccg
aggaggatgaagggactgaggatgaggagctcagccccttccgcggccgatcgctctcggcgccccccatcctctgggct
gcacagcgttatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A287AIU8_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A287AIU8_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A287AIU8_BMF-05 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=474 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaggagttcccgtcgtggcttggttaa
>gnl|bcl2dbcds|A0A287AIU8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A287AIU8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sus scrofa GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccgcaggcttgccccttggcgaacagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccagcagaaccaaaatcgtgtgtggtgg
caaatcctcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A287AZR7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=216 residues).
ttatctaaggaaacatttatggccaaaggaaaagtgctgtttgcaagtatgccacacagaagctccaataagaataccca
gacaaatcctctgaggttggcgctcccgccgctgcccgcggtcaaatgcagaatagggctaaggcgtgtgggcacaaagc
tggctatcaggcagcagataacaaatttcataatcttttttttttttttagggccg
>gnl|bcl2dbcds|C1KGB8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=294 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaaggagggtaatg
ctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|F1RM01_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagc
ccccgagatggagcctaattag
>gnl|bcl2dbcds|F1SMU1_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=366 residues).
gcgcgggcagcggcgggagcgccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccgcttgc
tcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttctcgga
gttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaaccctacg
cgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttccggca
gaaacttctgaatctgatagccaaactcttccgcctaggaacctga
>gnl|bcl2dbcds|F1SU81_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=552 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|F1SU81_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccactggccccaccgaccagccctggcccctttgctaccagatccccgcttttcatcttcgtgaga
agatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaaggagggtctttctgaataattaccaagcagccgaagcccaccctcagatggttatcttacgactgttacgcta
catcgcccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|F1SU81_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sus scrofa GN=BCL2L11 (length=384 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaaggcctcctca
gctcaggcctggggcccccacctctctacaaacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
gagggtaatgctgttttctttaccccccttttcccctcacaccctccctcccccttacatttaa
>gnl|bcl2dbcds|Q9GL49_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Sus scrofa GN=PMAIP1 (length=531 residues).
atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatcggcaggatgggaggaattggtaagaagcca
gccccgggcacatcaaggtctcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttccttcggtccgc
ctcccgctgccgtccgaggaaaccaaccaacctcagaggcttttgggcgttcagggtgttgcttttctagctctctcccg
cttgctcgcttctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgctcgggtccggggactgagttc
tcggagttttgcggcaaagttccggctgctgtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcagttcagaaggattggagacaaactgaacttc
cggcagaaacttctgaatctgatagccaaactcttccgtctaggaacctga
© 1998-2018