Dataset for CDS BBC3 of organism Sus scrofa

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F1RM01_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Sus scrofa GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctccgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccccaccctgc
tgcccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcggagcagcacctggaatcgcc
agtgcccagcgctccgggggccctggcgggcggccccacccaagcagccccgggaatccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggttctgtacaatctcatcatgggacttctgcccttacccaggggccgtggagc
ccccgagatggagcctaattag
© 1998-2018