Dataset for CDS classical BH3-containing proteins of organism Stegastes partitus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B5B8F6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Stegastes partitus GN=BMF (length=495 residues).
atggacgatgaggaggatgatgtttttgagccagacccccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctgcaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttattggggatcaccaagcgaggcaa
caacaaggaagtgaaatggagcaaaacgggatggagcagctgccccggcagcaacctgtggcgcgcagcgtggaggcttg
cattggacagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
aggggccgctgtggtggcgcctggccgcagccctactcagccttctgtttgacagggggttcattgctggaggaggtggt
gcaggacggaggtga
>gnl|bcl2dbcds|A0A3B5BAL2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Stegastes partitus GN=BAD (length=501 residues).
atggctgcacaattctctattagtggcagcgagtccgacccggaggaggtagaagagggagaaaacaaccatccaccagc
agaacagccgatgcatgtcttcgagcgccgcaacctcgccttacctgaactcagaaccccagccgccggccggatcaggc
tgaactcagagtcccacgcgaccacggtctccagagacgaggagctccaggccaggggggaagaggaggccggcacgccc
actgacggagctccgttcaggggacggtctaagtcggctccacctgcactgtgggccgccaagaagtacggccagaagct
gcgaaggatgagcgacgagtttgacagcctgctagataaaggggagatgaagagggtgaggagtgcagggacggccaaac
agatgcaccactctaaaagctggtggagctacctctttagtcaccaggagctggagggagagaacaaccaccatgaaaac
cacacacatcgcaatgagtag
© 1998-2019