Dataset for CDS BMF of organism Stegastes partitus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B5B8F6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Stegastes partitus GN=BMF (length=495 residues).
atggacgatgaggaggatgatgtttttgagccagacccccactgctggcgcacaacattcagggagataaagtgtgaaga
ccggggcacacagactcctggtcctgccctgcaaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtaacgcaggttttcgattgcacttcccagcacgctttgagcttattggggatcaccaagcgaggcaa
caacaaggaagtgaaatggagcaaaacgggatggagcagctgccccggcagcaacctgtggcgcgcagcgtggaggcttg
cattggacagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
aggggccgctgtggtggcgcctggccgcagccctactcagccttctgtttgacagggggttcattgctggaggaggtggt
gcaggacggaggtga
© 1998-2019