Dataset for CDS BCL2L11 of organism Seriola lalandi dorsalis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B4XZH1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L11 (length=651 residues).
atgaaagcccaggctgacggtgccgctctattcatccaacagaccacaaaaccggtccgatggctcgaccgcagtaacgg
caagaggggagagcgaaggggatccaccactcgtcggtgccgctggagccccggcgcaaaaccccagttcgaaagacagc
ggcgagcggaaaccatagccacctctcctggcaacagcctaggcgtgtttcaaaagaggtctatattcagctaccctcgt
cgctcgtccagtggatatttctccttcgacagcgactcgctaccgacctccccgctctccccgaggccagccacggctga
acgaaccacgcagaccccgagccccaccagccaggtgatgaaacacgccttgcagcgcatggcggaggcgcacggcggag
gagcgaggatgcagcagcagcagcacggtgagcacaggcactttgcatcaggggacatgcaggcggaggcagtcggacaa
gagctccgacgcatcggagacgactttaatagacttctcctgttaagggtcagtcatcacagatggtgtgtgtgtgtgtg
tgtgtgtgtgtgtgcgtgcgggtgtgtgtgtgcgtgcgggtgtgtgtgcgggtgtgtgcgggtgtgtggtggtggagggg
gggtagagtag
© 1998-2019