Dataset for CDS BMF of organism Seriola dumerili

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B4U5H8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Seriola dumerili GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcgcaccacattcagggagataaagtgtgaaga
ccggggcacacaaacacctggcccagccctggcactgaacaacggcatgctgccctgtggagtcgcaaaggagcccagac
cactcttctacggcaacgcaggttttcgattgcacttcccggcacattttgagcttgttggggatcaggaagcgaggcga
caaggaagcggagaggagcgaaacgggatggagcagctaccccggcagcagcctgtggcgcgcagtgtggaggcctgcat
tggtcagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcaaaaccaaaggaaccagg
ggccgctgtggtggcgcctggccgtagctctgctcagccttctgtttgacagggggttaattgctggaggaggtggagca
ggacggaggtga
>gnl|bcl2dbcds|A0A3B4UNJ0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Seriola dumerili GN=BMF (length=420 residues).
atggatgatgaggaggaggacatgtcacagcccatctcgcacctctggggaacgtcctttagggacgtcaaatacgaaga
ccgagccacaccgattgcagccggacaggcccttactgccgtcaccgctgctcctctcattctttttgtttggtgggttc
ctcattgggaactgtcccccagtaccaaaatgaatatgttaagattctcagagaataggcccgaggagcaggcaggggtg
agcgtcgaggcgcaaattggccgtaaacttcgggagattggagacaagttccaacaggatcatttcatgaggcaccagag
acaaaacctgcctgcctggatgcgccttacgatggccctgtttggctttctgtttccaagacaggctctcgtcccccgcc
tgagaggagagcagagatga
© 1998-2019