Dataset for CDS BCL2L11 of organism Seriola dumerili

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B4V919_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L11 (length=519 residues).
atgaaagcccaggctgacggtgccgctctattcatccaacagaccacaaaaccggtccgatggctcgaccgcagtaacgg
caagaggggagagcgaaggggatccaccactcgtcggtgccgctggagccccagcgcaaaaccccagttcgaaagacagc
ggcgagcggagccttggccacctcggctccaccggagaaggagagccagactcgccgccccggtgcagaaccatagccac
ctctcctgtcaacacttctctcgtcgctcgtccagtggatatttctccttcgacagcgactcgctaccgagctccccgct
ctccccgaggccagccacggttgaacgaaccacgcagaccccgagccccaccagccaggtgatgaaacacgccttgcagc
gcatggcggaggcgcacggcggaggagcgaggatgcagcagcagcacggtgagctaaaacctgcgcttctaaaacacact
aagatgacttctcagtgctgccaaacccatttctgctga
© 1998-2019