Dataset for CDS classical BH3-containing proteins of organism Scophthalmus maximus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2U9BAC9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Scophthalmus maximus GN=BAD (length=504 residues).
atggcggcaaacttcacaatatcagacagtgagtcagagccatcggaggaggtggaggaaggagaagtgagccaaccgtg
gaccgggccaggggagcaggttcctccgcgccacaccctcgccctccctgagctgcgaatggcagcaaccggtcgaatcc
ggctgaactcggagtccaacgcttccactctctcacgagacgaggagctcctgaccaggtgggacgaggaagccggtacg
cccaccgacggagctccattccgggggaggtccaagtcggctcctcctgcgctgtgggcggccatgaaatacggccagaa
gctccggcggatgagtgacgagtttgacagcctgctagacaaaggggagatgaggaaggtgaagagcgccgggacggcca
gacagatgcaccactctcaaagctggtggagctacctctttagtcaccaggagatggaaggagaaaacaaccaccacgag
aaccacactcaacgcaacgagtag
>gnl|bcl2dbcds|A0A2U9CJH3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Scophthalmus maximus GN=BMF (length=654 residues).
atggacgatgaggaggatgatgtctttgagccagacccccactgctggcgcaccacattcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccctggcactgaacaacggcatgctgccctgtggagttgcagaggagcccagac
cactcttctacggcaacgcgggttttcgattgcacttcccggcacactttgagctttttggggatcaggaagtgagggga
cacgagagcgaagaggagcgaagcgggatggagcagctaccgcggcagcagcagcctgtggcgcacagcgtggaggcctg
cattggccagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
aggggccgctgtggtggcgcctggccgcagctctgctcagccttctgtttgacagggggttccttgctggaggaggtgga
gcgggacggaggcaggcgcacacaaaacgcagggcgaaagcctccgggccgcagaaccgggccagttcagtggagaggac
ggtccaggcgatgaccaaccagttcacctcactgccgcctcagcagctgccacctccagccaacggtcggcttccctgcg
cgctgattggctaa
© 1998-2019