Dataset for CDS BMF of organism Scophthalmus maximus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2U9CJH3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Scophthalmus maximus GN=BMF (length=654 residues).
atggacgatgaggaggatgatgtctttgagccagacccccactgctggcgcaccacattcagggagataaagtgtgaaga
ccggggcacacagacacctggccctgccctggcactgaacaacggcatgctgccctgtggagttgcagaggagcccagac
cactcttctacggcaacgcgggttttcgattgcacttcccggcacactttgagctttttggggatcaggaagtgagggga
cacgagagcgaagaggagcgaagcgggatggagcagctaccgcggcagcagcagcctgtggcgcacagcgtggaggcctg
cattggccagaaactccagctgataggagaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaacc
aggggccgctgtggtggcgcctggccgcagctctgctcagccttctgtttgacagggggttccttgctggaggaggtgga
gcgggacggaggcaggcgcacacaaaacgcagggcgaaagcctccgggccgcagaaccgggccagttcagtggagaggac
ggtccaggcgatgaccaaccagttcacctcactgccgcctcagcagctgccacctccagccaacggtcggcttccctgcg
cgctgattggctaa
© 1998-2019