Dataset for CDS classical BH3-containing proteins of organism Salmo salar

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|B5X1T1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=471 residues).
atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacatgatgagtctgaccactcaggaaccac
acactacccagaatttcagcgccattatgtctccactaggacgggcatcagaccacgaccaggtgggcgagtgcggctct
actccgagtcccaggtgtgctcccaggttggcagaagggacaacacagagtttcaggatgtgatgactcctactgaggag
ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctcctacactgtgggctgcaaagaaatatggccg
ccagctgaggaggatgagtgatgaatttgacacctggctcgacaaaggggaacccaagagagggataagcccaggagggg
tcaagcaggaggtctcccgaggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
>gnl|bcl2dbcds|B5XEF1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Salmo salar GN=BAD (length=444 residues).
atggactacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacgcaactcagaattccagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgcgctcccagg
ttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggagggtgggggtgatggggcttcattccga
ggtcgatcacagtctgctcctcctgcactatgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggtgcccaagagagggattatcccaagaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
© 1998-2018