Dataset for CDS classical BH3-containing proteins of organism Saimiri boliviensis boliviensis

[Download (right click)] [Alignment] [Repertoires]

19 sequence(s)

>gnl|bcl2dbcds|A0A2K6S6C4_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagagcgcgcaaccgagccccgcgcgggctccagcagaccttgaagtcgagtgtgccat
tcaactcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K6STD6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BBC3 (length=396 residues).
atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccagggcttcttccttgacgtgggtcccctgcca
gatgtgtggttctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggctcgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcagccgcaacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccagagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6TBD7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BIK (length=468 residues).
atgtctgaagacagacccctctccagcgacatcttgatggagactctcctgtgtgagcagtttgtggatcccctgaccat
ggaggttgtcggtgggagtgaccctgaagaggacccggactctgtggaggaccctttggaatgcatggagaacagtgacg
cactggccctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggcccggaggctggcccagctctacgag
gtggccacgtacagcccgggtctcgctttcatccttgaccggaccgacatcagggatgttcttagcggtgtcgtggatgt
tttcgctgacttccaggaggacatagtgaggctctggagatccctgagctctgggtcctgggtgtccggcaaacaggccg
tgctgctggcgctcctggcgctgctgctggcgatgttcagcgggggtctgcgcctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggagccgtggagacacggagtcgccacagctcgtaccccgcagggacg
gagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactccttcaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagagaatcccagtgcaaagatgctctcgaaagcatcagcagggatgtctgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggagccgtggagacacggagtcgccacagc
tcgtaccccgcagggacggagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgatatggccgcgagctccggaggatga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=432 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctc
cagctggacgcgagtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcccagtgaccttcgc
tccacatcccgaaactctacccgctcccatcgccctgggcggccatcttggacatgggcggaagtgcttcctgcagggag
ggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatccgaatggatataggtgat
atttcattgtggtttaggtttatatttaccttctttgatttgtatggctaccaccacagtcaaggtacagaacaactcca
ccacaagtatgtctcatga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccgcacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtatttttgaataattaccaagcagccgaagaccacccgcacatggttatcttacgactgttacgttacattgtcc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagccgaagaccacccgcacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttccacctgattga
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctgact
gggactag
>gnl|bcl2dbcds|A0A2K6TRZ5_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L11 (length=291 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacagttgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctcccttgcc
cttcgtagggaggttcagtgcccacttgagtggttagcaaaatcaagctga
>gnl|bcl2dbcds|A0A2K6TW86_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgccccttggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgtgtgtgg
tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccgaggtga
>gnl|bcl2dbcds|A0A2K6TW86_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BMF (length=555 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgccccttggggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgtgtgtgg
tggcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccgaggtga
>gnl|bcl2dbcds|A0A2K6TW86_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BMF (length=390 residues).
atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagccagaggatggggagccagggacccaacccgg
gagcttgctctctgctgacctgtttgcccagagcctactggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatgcaccagcagaaccgaaatcgtgtgtggt
ggcaggtcctcctcttcctgcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccgag
© 1998-2018