Dataset for CDS BBC3 of organism Saimiri boliviensis boliviensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6STD6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BBC3 (length=396 residues).
atgaaatgtggcatggggtctgcctgggcatgtccatgccaagtgcccagggcttcttccttgacgtgggtcccctgcca
gatgtgtggttctcagccctcgctctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggagcagtgggctcgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcagccgcaacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccaggggccacagagccccagagatggagcccaattag
© 1998-2018