Dataset for CDS BAD of organism Saimiri boliviensis boliviensis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2K6TG62_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=504 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggaggcgctggagccgtggagacacggagtcgccacagctcgtaccccgcagggacg
gagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcaccccccaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactccttcaagggacttcctcgcccgaagagcg
cgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgggatcggaacttgggcagg
ggaggctccgctccctcccagtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=432 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctc
cagctggacgcgagtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcccagtgaccttcgc
tccacatcccgaaactctacccgctcccatcgccctgggcggccatcttggacatgggcggaagtgcttcctgcagggag
ggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|A0A2K6TG62_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgagccccagcaccgc
aggggacagccccccaggctctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcaccagcagggac
agccaaccagcagcagccaccatggagagaatcccagtgcaaagatgctctcgaaagcatcagcagggatgtctgcccca
gccactgactcagaagcccaacacacagagaatgtaaagctggaggcgctggagccgtggagacacggagtcgccacagc
tcgtaccccgcagggacggagggggacgaagggatggaggaggagcccagcccttttcggggccgttcgcgctcggcacc
ccccaacctctgggcagcacagcgatatggccgcgagctccggaggatga
© 1998-2018