Dataset for CDS BMF of organism Rhinopithecus roxellana

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K6RAW8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus roxellana GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaagatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaataggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K6RAW8_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Rhinopithecus roxellana GN=BMF (length=372 residues).
atggagccatctcggtgtgtggaggagctggaagatgatgtgttccagccggaggacggggagccgggggcccaacctgg
gagctcgctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgttatgctgccttgtggggtaactgaggaaccccagcgactgttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaatag
© 1998-2018