Dataset for CDS BBC3 of organism Rhinopithecus roxellana

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K6QZU4_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccacccccgctgcccccgccctgc
tgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccggccccgaggcccacgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgcc
ggtgcccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagc
ccccgaaatggagcccaattag
>gnl|bcl2dbcds|A0A2K6QZU4_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BBC3 (length=396 residues).
ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccagggcttcttctgcgacgtgggtcccctgcca
gatttgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgccggtgcccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggag
ggtcctgtacaatctcattatgggactcctgcccttacccaggggccacagagcccccgaaatggagcccaattag
© 1998-2018