Dataset for CDS BIK of organism Rhinopithecus bieti

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6MCW0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rhinopithecus bieti GN=BIK (length=474 residues).
atgtctggagtaagacccgtctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctaggtctggctttcatctacgaccagaccgacgacatcagggatgttcttacaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccctgaatcccgggtcccaggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcggcgctgctcagcgggggcctgcacctgctgctcaagtga
© 1998-2018