Dataset for CDS BAD of organism Rhinopithecus bieti

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K6N1A1_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus bieti GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K6N1A1_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rhinopithecus bieti GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagagcttggtattatcctgctgaatctgaggactctgaaaatcccagtgca
aggatgctcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcccaactcgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
© 1998-2018