Dataset for CDS HRK of organism Rattus norvegicus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|P62817_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Rattus norvegicus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgaggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
© 1998-2018