Dataset for CDS classical BH3-containing proteins of organism Rattus norvegicus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|O35147_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=618 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggcgctgggactatggagac
ccggagtcgccacagttcgtacccagcggggactgaggaagatgaagggatggaggaggagcttagcccttttcgaggac
gctcgcgctcggctccccccaatctctgggcagcgcagcgctatggccgtgagctccgaagaatgagcgatgaatttgag
ggttccttcaagggacttcctcgcccaaagagcgcaggcactgcaacacagatgcgacaaagcgccagttggacgcgcat
tatccagtcctggtgggatcgaaatttggggaaaggaggctccactccctcccagtga
>gnl|bcl2dbcds|O88498_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggtccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagact
tacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgatt
catcttccgtctggtctggagaaggcactga
>gnl|bcl2dbcds|O88498_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaa
cctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgag
gagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttcc
gtctggtctggagaaggcactga
>gnl|bcl2dbcds|P62817_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Rattus norvegicus GN=HRK (length=279 residues).
atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcggttgcggcgacgctcgccccgggctgcgctg
ggcggcggcgcaggtgaccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccatgaggcgtcgcgcgc
ggccccgggacccgctgcccgcgctgctgcccgcgctccgcgcccgctggccctggctgtgcgcggccgcgcaggtggcg
gcgctggcggcctggctgctcggcaggcggagcgcgtag
>gnl|bcl2dbcds|Q5U777_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Rattus norvegicus GN=PMAIP1 (length=318 residues).
atgcccgggagaaaggcgcgtcggaacgcgccattgaacccaacgcgggcagagttaccgcctgaattcgcagctcagct
caggaagattggagataaagtgtactgcacgtggagtgcaccggacataactgcggttctggcgcagatgcctggcaaga
agtcgcgaaagagcacgatgagaagaagcccaagcccaacccgggtgccagcagacctgaaggacgagtgtgatcaactg
cggagaattggagacaaagtgaatttacggcagaaacttctgaattttatttccaagctcttcaatttaataacctga
>gnl|bcl2dbcds|Q6P7C5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Rattus norvegicus GN=BAD (length=345 residues).
atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggagcct
ggggagcgacgcgggaggaaggcggtggagaccagcagcccagagtatgttccagatcccagagtttgagccgagtgagc
aggaagacgctagtactacagataggggcctgggccctagcctcactgaggaccagccaggtccctacctggccccaggt
ctcctggggagcatcgttcagcagcagccgggacaggcagccaataacagtcatcatggaggtaggttcctcacttccat
cattttcctgtcccatgtcccctga
>gnl|bcl2dbcds|Q80ZG6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Rattus norvegicus GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctctccggagcccgtagagggcctagcccgcgacagcccgcgtcctttcccgct
cggccgcctgatgccctccgctgtatcctgcggcctctgcgagcccggcctgcccgctgcccctgctgcccctgccttgc
tgccggccgcctacctctgcgcccccaccgccccgcctgccgtcaccgccgccctggggggcccccgctggcctgggggt
caccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctgtcaccagcccagcagcacctagagtcgcc
cgtgcccagcgccccggaggccctggcgggaggccccacccaagctgccccgggagtgcgtgtggaggaggaggagtggg
cccgggagatcggggcccagctgcggaggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaagagcaa
catcgacaccgaccctcgccctggagggtcatgtataatctcttcatgggactcctccccttacccagggatcctggagc
cccagaaatggagcccaactag
>gnl|bcl2dbcds|Q8K589_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rattus norvegicus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggaactagaagatgatgtgttccagccagaggatggggagccagggacacagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggattgtcccctcagtcggcttcagctcttcccgcttaccc
actgctgtggtcctgggctccggcctgtaagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccccgcaggctcagcccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtacaga
tcgccagaaagcttcagtgcattgcagaccagttccatcggcttcatatgcaacaacaccagcagaaccgagaccgagca
tggcggcaggtcttcctcttccttcaaaacctggccttgaacagacgagaaaacagggaaggggtgggtccctggtga
>gnl|bcl2dbcds|Q925D2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rattus norvegicus GN=BIK (length=477 residues).
atgtcagaggcgagactaatggccagagacattatcaagactcttctacacgaccaggtcccccaacctgcagtggtctc
tggggctcccagcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttggatttcatgaggtgcctgg
agagcagaaaccaggtggccctgaggctagcctgcatcggcgatgagatggaccggtgtcttcggagcccccgtctggtc
cagctgcctgggattgctatgcacagacttgctgccacctacagccagacgggtgtcagaggtattttcagaagcttgat
tggaagcctcaccaacctcagggaaaatatctggtcctggagagtcttcactcctggcgcctgggtgtcacctgaccagg
accctgggcagctgtttcccatggtgctgctggtcttcttgctgctgggtggggcctggcatttgcagcttcagtga
© 1998-2018