Dataset for CDS BMF of organism Rattus norvegicus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q8K589_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Rattus norvegicus GN=BMF (length=558 residues).
atggagccacctcagtgtgtggaggaactagaagatgatgtgttccagccagaggatggggagccagggacacagcctgg
gagcttgctctctgctgacctgtttgcccagagccagctggattgtcccctcagtcggcttcagctcttcccgcttaccc
actgctgtggtcctgggctccggcctgtaagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgacagaggaaccccagagactcttttacggcaacgctggctacaggcttcctctccc
tgccagtttccccgcaggctcagcccttggggagcagccccctgaaggacagttccttcagcaccgagcagaggtacaga
tcgccagaaagcttcagtgcattgcagaccagttccatcggcttcatatgcaacaacaccagcagaaccgagaccgagca
tggcggcaggtcttcctcttccttcaaaacctggccttgaacagacgagaaaacagggaaggggtgggtccctggtga
© 1998-2018