Dataset for CDS BIK of organism Rattus norvegicus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q925D2_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Rattus norvegicus GN=BIK (length=477 residues).
atgtcagaggcgagactaatggccagagacattatcaagactcttctacacgaccaggtcccccaacctgcagtggtctc
tggggctcccagcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttggatttcatgaggtgcctgg
agagcagaaaccaggtggccctgaggctagcctgcatcggcgatgagatggaccggtgtcttcggagcccccgtctggtc
cagctgcctgggattgctatgcacagacttgctgccacctacagccagacgggtgtcagaggtattttcagaagcttgat
tggaagcctcaccaacctcagggaaaatatctggtcctggagagtcttcactcctggcgcctgggtgtcacctgaccagg
accctgggcagctgtttcccatggtgctgctggtcttcttgctgctgggtggggcctggcatttgcagcttcagtga
© 1998-2018