Dataset for CDS BCL2L11 of organism Rattus norvegicus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|O88498_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaagacaggagcccggcacccatgagttgtgacaagtcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaa
cctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgag
gagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttcc
gtctggtctggagaaggcactga
>gnl|bcl2dbcds|O88498_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagaatcgcaaggtaatcccgacggcgaaggggaccgctgcccccacg
gcagccctcagggcccgctggccccaccggccagccctggtccttttgctaccagatccccacttttcatctttgtgaga
agatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctc
aggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagact
tacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgatt
catcttccgtctggtctggagaaggcactga
© 1998-2018