Dataset for CDS Unclassified of organism Pygocentrus nattereri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B4DQ45_uncBBC3-01 Putative BCL2 binding component 3 gene OS=[Eukaryota] Pygocentrus nattereri (length=561 residues).
atggctcggccgcagatggacagcagggtggacagtcagagtcccacggcaccgcagagctgcaggatggaggtgctgcg
tcgggacgcctggcccagtggaggcacacattcagcctctcaggcccgccaccggcatcggaccatggccactcagacca
gccctgtactcctgtcccatgcccgcacacaagatgctgcaagcttgcccaacaccaaccagcaagacggcccacttaga
gacaacacaggaaccgaaccggagcggtcctcatctgctgagacacagcagcctctgcatgatctcacagctgaaagcca
cagttcctcagcagactccagccgcagagaatcccctgccgaggaggagcccacgccggaggagcaagccatccatagag
tggccatccagctgaggaccataggggatgacatgaatgcagtttaccttcagagaaggaacgaggctcctcagtggcag
aactggagaggcctgtatcgtggtttggtggccttccttgctgacaccatcagcaccctctaccagcatggagtcagata
a
© 1998-2019