Dataset for CDS classical BH3-containing proteins of organism Pygocentrus nattereri

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A3B4BVX1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L11 (length=660 residues).
cttctgtccgccagaaaagctcgtttcagtgtttgcccgtgttcttctccggaggaccgtatacatcaccttcctcatta
tctgcggtcaaaccgggccggccgcccagccttcttaaaggagcagggggagagtggtcagagcagcggagcagcctcct
cccgggccgccgagcagtgcgagcagcctgagcccggcgagggggacccggttaggggagggattacaatgcctaatagc
cttctgggttaccagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcggatacttttcgtttgagagcga
gcccagctctccgctcgtgacgcacagcgcgtccacgcagacccccagcccgtctagtcaagtaatcactcacgccctgc
agcgcattgctgaggcgcgagggaacgctcagactttcgaattatggcccctctataaccaccatccgccccacggagca
gcgcctgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagtttaacgagcttta
ttttcacggggtgagtcagctgcatgggtgcgttgctggtatgcaagcgttgagtaatcctgttgccttttcaatcctgg
ggctttttcgtggacactga
>gnl|bcl2dbcds|A0A3B4BVX1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L11 (length=492 residues).
atgcagaacagtaattactgctgttttgagcagggggagagtggtcagagcagcggagcagcctcctcccgggccgccga
gcagtgcgagcagcctgagcccggcgagggggacccggttaggggagggattacaatgcctaatagccttctgggttacc
agtcgcgttcgcctctcttccgaacactatccaggtcctcaagcggatacttttcgtttgagagcgagcccagctctccg
ctcctgacctctccttctctgtctgtgtgttccacagaattatggcccctctataaccaccatccgccccacggagcagc
gcctgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagtttaacgagctttatt
ttcacggggtgagtcagctgcatgggtgcgttgctggtatgcaagcgttgagtgctcgagatctgcacgatcaaatgttt
gctttaagctaa
>gnl|bcl2dbcds|A0A3B4BVX1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L11 (length=609 residues).
atgtccaggcggtcaaaccgggccggccgcccagccttcttaaaggagcagggggagagtggtcagagcagcggagcagc
ctcctcccgggccgccgagcagtgcgagcagcctgagcccggcgagggggacccggttaggggagggattacaatgccta
atagccttctgggttaccagtcgcgttcgcctctcttccgaacactatccaggtcctcaagcggatacttttcgtttgag
agcgagcccagctctccgctcgtgacgcacagcgcgtccacgcagacccccagcccgtctagtcaagtaatcactcacgc
cctgcagcgcattgctgaggcgcgagggaacgctcagactttcgaattatggcccctctataaccaccatccgccccacg
gagcagcgcctgcgggggacatgcgaccggagtcgtacgtggcgcaagagctgcggcgcatcggcgatgagtttaacgag
ctttattttcacggggcaggcagaaatggaggcagagtccagctgccggcggaggaggaacctgccttcatgctgtggct
ggggctcgtgatcagacgcctattagaggtcctcctaagacgaagatga
>gnl|bcl2dbcds|A0A3B4CNJ8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Pygocentrus nattereri GN=BMF (length=468 residues).
atggatgaagatgaagatgatgtttttgtgatggatacacaatattggcgttcctcaatcagggagataaagcaggagga
gcgtggcactcagactccggggcggccgccagctcggcccaacggcatgctgccctgtggagtgtctgaggagccaagac
gcctattctacggtagcgcaggattgctactactagcaccatctgtccgtcctgaacacgttgagggtgccatgcttcag
gaggaccagctcgccatggaacctcggagacggcccccacacagtgtggaggcccgtatcggtcagaagctccagatgat
cggagatcagttctatcaagagcacatgctgcaacacagaaaccaaaggaaccagcagcccttttggttgcgtttggcat
cagcgttgtacacgctcctgtttgagagagagccggtggctaatgggaggagagtggaccagaggtga
>gnl|bcl2dbcds|A0A3B4CPH6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pygocentrus nattereri GN=BAD (length=477 residues).
atggctcatatgttcacattatcggacgactcagacacatctgaagatctaggagacgcagaccagccagaagccagtaa
gagagctgagctgtcacagtctgggcagcacccacttgttccagagagattcagagagtcaaggcagaggaatcactcta
tgaatgaggatgcccttcaggaatctggggctgtgagacatggagatggagctgcagatggagactctttccgccgtcgc
tgtcgctcggctccccctgctctgtgggcagcaaagaaatatggcagacagctgaggaagatgagtgacgagttcgacac
cttgctggacaaagggatgaagagagtgaggagtgcaggtgcagcccgtcagatgcacgcttcccccagctggttcacct
tcttatggagccacaaagagtcagactctgaggccagcagcagtctaacagctccagacacccgtccggcagagtga
>gnl|bcl2dbcds|A0A3B4DUY7_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pygocentrus nattereri GN=BAD (length=621 residues).
atgagcaatcaatatctgcagaaactgaggagagctcgttttaattgcgaagaggagcgatataagaaagtaattaaaac
actgactggagagaaaggaacgccttttaacccattgtgctggaattcattaagaaccacagcttgcgcaatggaaaagc
acagtgaagatggcataagtaccatggatgaccaagatgaatccaattggtcagagacggtcaagaatggtgactctcca
cagctggacagtcagcacagcatggcaagcaacatatcaccagcttccccagacgaactgtcagaggttgggtgtcgtgt
tcggctgtactctgagtcccaggtgtacacggtcagccgctggcaggacaatgaggatgggcttttagcggaggacggtg
gagcaggggatggagctccattccgaggccgatcccagtcggctcctgctgcactgtggaaagccaagaaatatgggcgg
cagctgaggaggatgagtgatgaatttgacacctggctggataaaggggacacaagaagagcgagcagccctgggaagca
gacgaaccgaggatggttctcttttctctggggttccaaagaagaagaaggaagagaataa
© 1998-2019