Dataset for CDS HRK of organism Propithecus coquereli

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6GL98_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Propithecus coquereli GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctgggtctgcgctc
gtccgccgcgcagctcacagccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2018