Dataset for CDS classical BH3-containing proteins of organism Propithecus coquereli

[Download (right click)] [Alignment] [Repertoires]

14 sequence(s)

>gnl|bcl2dbcds|A0A2K6EM90_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Propithecus coquereli GN=PMAIP1 (length=165 residues).
atgcccgtgaagaaggcgcgtaagaacgcgcaaccgagcccgacgcggactcgggcagagatcgaagaggagtgtgccct
tcaactcaggagacttggagacaaactgcatttccagcagaaacttctgaatctgatagccaaacttttccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A2K6FFR1_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Propithecus coquereli GN=BMF (length=390 residues).
atggagccatcccactgtgtggaggagctggaggatgatgtgttccagccagaggatggggagtcggggacccagcccgg
gagcgtgctctctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagagactcttttatgcaccagcagaaccaaaatcgcatgtggt
ggcagatcctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacggggcaggtcccag
>gnl|bcl2dbcds|A0A2K6FFR1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Propithecus coquereli GN=BMF (length=555 residues).
atggagccatcccactgtgtggaggagctggaggatgatgtgttccagccagaggatggggagtcggggacccagcccgg
gagcgtgctctctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagagactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttccctgcaggcttgccccttggggaacagcccgctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccaaaatcgcatgtgg
tggcagatcctcctcttcctacacaaccttgctttgaacggagaagagaacaggaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A2K6FM79_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Propithecus coquereli GN=BIK (length=459 residues).
atgtctgaggtgagacccgtctccacggacctcctcatggagaccttcccgttcgagcatctcctggaccctctgatcct
ggaggttctcagcatcatggacaacgaggagaatcccgacccctcggggtgcctcgaggacagtgacgaggtggccctgc
ggctagcctgcattggggatgagatggacctgtgtctcaggagcccccgcctggcctggctgcccgggatgaccatgcac
agcctggggctggcgctgtcctgtgaccagccggtccgctggggcgtgctcgggagccttagcgacggtttcgccaacct
cagggagtacgtggccaggctctggaggtcgctcagcccccggccctgggtgtgccccgccccggcgtgggagcaggtgc
tgctgctgctgctggtgctgctgctgctgggcgggggcctgcacctgctgctcaagtga
>gnl|bcl2dbcds|A0A2K6FQZ3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=582 residues).
atggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cggccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgctgcccccgccgcccccgccctgc
tacccgctgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
ccccgcagccgaccccgaggcccgcgcccggacggtcctcagccatcactctcgctggcagagcagcacctggagtcgcc
cgtccccagcgccccgggggccctggcgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcagacgacctcaatgcgcagtacgagcggcggagacaagaggagcag
cagagacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagc
ccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6FQZ3_BBC3-04 BCL2 binding component 3 gene OS=[Eukaryota] Propithecus coquereli GN=BBC3 (length=396 residues).
atgaaatttggtgcggggtctgcccgggcatgtccctgccaggtgcccgggacttccttctcatggtgggtcctgggcca
tattcctggtcctcagccatcactctcgctggcagagcagcacctggagtcgcccgtccccagcgccccgggggccctgg
cgggcggtcccacccaggcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcagacgacctcaatgcgcagtacgagcggcggagacaagaggagcagcagagacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacagagcccctgagatggagcccaattag
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaagcttccatgaggcaatttcaggctgaacctgcagata
tgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaaggaggctggca
aaatgcctggtaccctccatctga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgcttatcttgcg
actgttacgttacattgtccgcctggtgtggaggaggcattga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcaatttcaggctgaa
cctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgagtttaacgcttattacccaag
gagggtatttttgaataattaccaagccgacgaagaccaccctcaaatgcttatcttgcgactgttacgttacattgtcc
gcctggtgtggaggaggcattga
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
tgaggcaatttcaggctgaacctgcagatatgcgcccggagatatggatcgcgcaggagttgcggcgtattggagatgag
tttaacgcttattacccaaggaggatgcctcttccatctgattaa
>gnl|bcl2dbcds|A0A2K6GE31_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaggttctgagtgtgaccgagaaggtggacagttgcaatctgtggagagacctcccca
gctcaggcctggggcccctacctccctacagacagagccccaaggtaatcccgaaggcagtcgggaaggcgaaggggacc
gctgctcccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K6GL98_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Propithecus coquereli GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctgggtctgcgctc
gtccgccgcgcagctcacagccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccagcgcccggcgcgctcaccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A2K6GWV0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Propithecus coquereli GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgcaggtaggggcctgggccccagcccctc
aggggaccggccctcaggccccggcaagcatccctgcacggctccaagcttcctgggggacgccagtcaccagcaggggc
agcccagcagcagcagccaccatggaggagctgggtctgtggagacccggagtcgccacagctcgtaccccgcggggaca
gaagaggatgaagggatggaggaagagcccagccccttccggggccgctcacgctcggcgccccccaacctctgggctgc
acagcgctatggccgcgagctccggaggatgagcgacgagttcgaggactccttcaagaagggacttcctcgcccgaaga
gcgcgggcacagcgacgcagatacggcagagctccagctggacgcgcgtcattcagtcctggtgggatcggaacgtgggc
aggggaggttccgccccctcccagtga
© 1998-2018