Dataset for CDS BIK of organism Propithecus coquereli

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6FM79_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Propithecus coquereli GN=BIK (length=459 residues).
atgtctgaggtgagacccgtctccacggacctcctcatggagaccttcccgttcgagcatctcctggaccctctgatcct
ggaggttctcagcatcatggacaacgaggagaatcccgacccctcggggtgcctcgaggacagtgacgaggtggccctgc
ggctagcctgcattggggatgagatggacctgtgtctcaggagcccccgcctggcctggctgcccgggatgaccatgcac
agcctggggctggcgctgtcctgtgaccagccggtccgctggggcgtgctcgggagccttagcgacggtttcgccaacct
cagggagtacgtggccaggctctggaggtcgctcagcccccggccctgggtgtgccccgccccggcgtgggagcaggtgc
tgctgctgctgctggtgctgctgctgctgggcgggggcctgcacctgctgctcaagtga
© 1998-2018